United States
Germany
Japan
United Kingdom
China
MRPL55 (NM_181462) Human Untagged Clone
CAT＃: SC317262
MRPL55 (untagged)-Human mitochondrial ribosomal protein L55 (MRPL55), nuclear gene encoding mitochondrial protein, transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AAVG5835; L55nt; MRP-L55; PRO19675 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317262 representing NM_181462.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCCGTGGGCAGCCTGCTTGGCCTGGCAGCCTCTTCCTGGCTAGGGGGCCAGAACGCCTCTGAC CACAGCCTGTGGCTCCTGAGGAAGCCCCGAGGCTCATCCTGCCCCGGCACGGGTCACCAGCTCTGCCGG CTGAGGCAGAGCACCGTGAAGGCCACCGGACCTGCACTCCGCCGCCTGCACACATCCTCCTGGCGAGCT GACAGCAGCAGGGCCTCACTCACTCGTGTGCACCGCCAGGCTTATGCACGACTCTACCCCGTGCTGCTG GTGAAGCAGGATGGCTCCACCATCCACATCCGCTACAGGGAGCCACGGCGCATGCTGGCGATGCCCATA GATCTGGACACCCTGTCTCCTGAGGAGCGCCGGGCCAGGCTGCGGAAGCGTGAGGCTCAGCTCCAGTCG AGGAAGGAGTACGAGCAGGAGCTCAGTGATGACTTGCATGTGGAGCGCTACCGACAGTTCTGGACCAGG ACCAAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_181462 |
| Insert Size | 495 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_181462.2 |
| RefSeq Size | 882 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 128308 |
| UniProt ID | Q7Z7F7 |
| MW | 18.9 kDa |
| Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding two different isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) contains an alternate in-frame segment when compared to variant 5. The predicted protein (isoform b) is longer than isoform a. The predicted ORF of this transcript has not been experimentally confirmed. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222134 | MRPL55 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L55 (MRPL55), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 1,200.00 |
|
| RC222134L3 | Lenti ORF clone of Human mitochondrial ribosomal protein L55 (MRPL55), nuclear gene encoding mitochondrial protein, transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222134L4 | Lenti ORF clone of Human mitochondrial ribosomal protein L55 (MRPL55), nuclear gene encoding mitochondrial protein, transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
| RG222134 | MRPL55 (tGFP-tagged) - Human mitochondrial ribosomal protein L55 (MRPL55), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 4,370.00 |
