DHRS4L2 (NM_198083) Human Untagged Clone
CAT#: SC317337
DHRS4L2 (untagged)-Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SDR25C3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317337 representing NM_198083.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGATGGCCAGGCTGCTAGGCCTCTGTGCCTGGGCACGGAAGTCGGTGCGGATGGCCAGCTCCAGG ATGACCCGCCGGGACCCGCTCACAAATAAGGTGGCCCTGGTAACGGCCTCCACCGACGGGATCGGCTTC GCCATCGCCCGGCGTTTGGCCCAGGACAGGGCCCACGTGGTCGTCAGCAGCCGGAAGCAGCAGAATGTG GACCAGGCGGTGGCCACGCTGCAGGGGGAGGGGCTGAGCGTGACGGGCACTGTGTGCCATGTGGGGAAG GCGGAGGACCGGGAGCGGCTGGTGGCCATGGCTGTGAAGCTTCATGGAGGTATCGATATCCTAGTCTCC AATGCTGCTGTCAACCCTTTCTTTGGAAGCCTAATGGATGTCACCGAGGAGGTGTGGGACAAGACTCTG GACATTAATGTGAAGGCCCCAGCCCTGATGACAAAGGCAGTGGTGCCAGAAATGGAGAAACGAGGAGGC GGCTCAGTGGTGATCGTGTCTTCCATAGCAGCCTTCAGTCCATCTCCTGGCTTCAGTCCTTACAATGTC AGTAAAACAGCCTTGCTGGGCCTCAACAATACCCTGGCCATAGAGCTGGCCCCAAGGAACATTAGGGTG AACTGCCTGCACCTGGACTTATCAAGACTAGCTTCAGCAGGATGCTCTGGATGGACAAGGAAAAAGAGG AAAGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_198083 |
Insert Size | 699 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_198083.3 |
RefSeq Size | 1384 bp |
RefSeq ORF | 699 bp |
Locus ID | 317749 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Retinol metabolism |
MW | 24.9 kDa |
Gene Summary | This gene encodes a member of the short chain dehydrogenase reductase family. The encoded protein may be an NADPH dependent retinol oxidoreductase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in other species. An alternative downstream start codon, which is specific to human and has a slightly stronger Kozak signal, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 2 aa shorter at the N-terminus. There is no experimental evidence showing which start codon is preferentially used in vivo. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215019 | DHRS4L2 (Myc-DDK-tagged)-Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1 |
CNY 2,400.00 |
|
RC215019L1 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC215019L2 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC215019L3 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215019L4 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG215019 | DHRS4L2 (tGFP-tagged) - Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1 |
CNY 4,000.00 |
|
SC126075 | DHRS4L2 (untagged)-Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1 |
CNY 3,990.00 |
其它DHRS4L2产品