WDR68 (DCAF7) (NM_005828) Human Untagged Clone

CAT#: SC317530

DCAF7 (untagged)-Human DDB1 and CUL4 associated factor 7 (DCAF7)



  "NM_005828" in other vectors (7)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
DCAF7 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AN11; HAN11; SWAN-1; WDR68
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317530 representing NM_005828.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCCTGCACGGCAAACGGAAGGAGATCTACAAGTATGAAGCGCCCTGGACAGTCTACGCGATGAAC
TGGAGTGTGCGGCCCGATAAGCGCTTTCGCTTGGCGCTGGGCAGCTTCGTGGAGGAGTACAACAACAAG
GTTCAGCTTGTTGGTTTAGATGAGGAGAGTTCAGAGTTTATTTGCAGAAACACCTTTGACCACCCATAC
CCCACCACAAAGCTCATGTGGATCCCTGACACAAAAGGCGTCTATCCAGACCTACTGGCAACAAGCGGT
GACTATCTCCGTGTGTGGAGGGTTGGTGAAACAGAGACCAGGCTGGAGTGTTTGCTAAACAATAATAAG
AACTCTGATTTCTGTGCTCCCCTGACCTCCTTTGACTGGAATGAGGTGGATCCTTATCTTTTAGGTACC
TCAAGCATTGATACGACATGCACCATCTGGGGGCTGGAGACAGGGCAGGTGTTAGGGCGAGTGAATCTC
GTGTCTGGCCACGTGAAGACCCAGCTGATCGCCCATGACAAAGAGGTCTATGATATTGCATTTAGCCGG
GCCGGGGGTGGCAGGGACATGTTTGCCTCTGTGGGTGCTGATGGCTCGGTGCGGATGTTTGACCTCCGC
CATCTAGAACACAGCACCATCATTTACGAAGACCCACAGCATCACCCACTGCTTCGCCTCTGCTGGAAC
AAGCAGGACCCTAACTACCTGGCCACCATGGCCATGGATGGAATGGAGGTGGTGATTCTAGATGTCCGG
GTTCCCTGCACACCTGTCGCCAGGTTAAACAACCATCGAGCATGTGTCAATGGCATTGCTTGGGCCCCA
CATTCATCCTGCCACATCTGCACTGCAGCGGATGACCACCAGGCTCTCATCTGGGACATCCAGCAAATG
CCCCGAGCCATTGAGGACCCTATCCTGGCCTACACAGCTGAAGGAGAGATCAACAATGTGCAGTGGGCA
TCAACTCAGCCCGACTGGATCGCCATCTGCTACAACAACTGCCTGGAGATACTCAGAGTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_005828
Insert Size 1029 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005828.4
RefSeq Size 6394 bp
RefSeq ORF 1029 bp
Locus ID 10238
UniProt ID P61962
Domains WD40
MW 38.9 kDa
Gene Summary This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...