HS6ST1 (NM_004807) Human Untagged Clone

CAT#: SC317658

HS6ST1 (untagged)-Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1)



  "NM_004807" in other vectors (6)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HS6ST1 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HH15; HS6ST
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_004807, the custom clone sequence may differ by one or more nucleotides


ATGCGGCGGCGGCGCGCCGGCGGCAGGACCATGGTTGAGCGCGCCAGCAAGTTCGTGCTGGTGGTGGCGG
GCTCGGTGTGCTTCATGCTCATCTTGTACCAGTACGCGGGCCCAGGACTGAGCCTGGGCGCGCCCGGCGG
CCGCGCGCCGCCCGACGACCTGGACCTGTTCCCCACACCCGACCCCCACTACGAGAAGAAGTACTACTTC
CCGGTCCGCGAGCTGGAGCGCTCGCTGCGCTTCGACATGAAGGGCGACGACGTGATCGTCTTCCTGCACA
TCCAGAAGACGGGCGGCACCACCTTCGGCCGCCACCTCGTGCAGAACGTACGCCTCGAGGTGCCGTGCGA
CTGCCGGCCCGGCCAGAAGAAGTGCACCTGCTACCGGCCCAACCGCCGCGAGACTTGGCTCTTCTCCCGC
TTCTCCACCGGCTGGAGCTGCGGGCTGCACGCCGACTGGACCGAGCTCACCAACTGCGTGCCCGGCGTGC
TGGACCGCCGCGACTCCGCCGCGCTGCGCACGCCCAGGAAGTTCTACTACATCACCCTGCTACGAGACCC
CGTGTCCCGCTACCTGAGCGAGTGGCGGCATGTGCAGAGGGGTGCCACGTGGAAGACGTCGTTGCATATG
TGTGATGGGCGCACGCCCACGCCTGAGGAGCTGCCGCCCTGCTACGAGGGCACGGACTGGTCGGGCTGCA
CGCTACAGGAGTTCATGGACTGCCCGTACAACCTGGCCAACAACCGCCAGGTGCGCATGCTGGCCGACCT
GAGCCTGGTGGGCTGCTACAACCTGTCCTTCATCCCCGAGGGCAAGCGGGCCCAGCTGCTGCTCGAGAGC
GCCAAGAAGAACCTGCGGGGCATGGCCTTCTTCGGCCTGACCGAGTTCCAGCGCAAGACGCAGTACCTGT
TCGAGCGGACGTTCAACCTCAAGTTCATCCGGCCCTTCATGCAGTACAATAGCACGCGGGCGGGCGGCGT
GGAGGTGGATGAAGACACCATCCGGCGCATCGAGGAGCTCAACGACCTGGACATGCAGCTGTACGACTAC
GCCAAGGACCTCTTCCAGCAGCGCTACCAGTACAAGCGGCAGCTGGAGCGCAGGGAGCAGCGCCTGAGGA
GCCGCGAGGAGCGTCTGCTGCACCGGGCCAAGGAGGCACTGCCGCGGGAGGATGCCGACGAGCCGGGCCG
CGTGCCCACCGAGGACTACATGAGCCACATCATTGAGAAGTGGTAG


Restriction Sites Please inquire     
ACCN NM_004807
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004807.2, NP_004798.3
RefSeq Size 3966 bp
RefSeq ORF 1236 bp
Locus ID 9394
UniProt ID O60243
Protein Families Transmembrane
Protein Pathways Heparan sulfate biosynthesis
Gene Summary The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...