DPP1 (CTSC) (NM_001114173) Human Untagged Clone

CAT#: SC318774

CTSC (untagged)-Human cathepsin C (CTSC), transcript variant 3



  "NM_001114173" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CTSC rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPPI; DPP-I; DPP1; DPPI; HMS; JP; JPD; PALS; PDON1; PLS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001114173, the custom clone sequence may differ by one or more nucleotides
ATGGGTGCTGGGCCCTCCTTGCTGCTCGCCGCCCTCCTGCTGCTTCTCTCCGGCGACGGC
GCCGTGCGCTGCGACACACCTGCCAACTGCACCTATCTTGACCTGCTGGGCACCTGGGTC
TTCCAGGTGGGCTCCAGCGGTTCCCAGCGCGATGTCAACTGCTCGGTTATGGGACCACAA
GAAAAAAAAGTAGTGGTGTACCTTCAGAAGCTGGATACAGCATATGATGACCTTGGCAAT
TCTGGCCATTTCACCATCATTTACAACCAAGGCTTTGAGATTGTGTTGAATGACTACAAG
TGGTTTGCCTTTTTTAAGGATGTCACTGATTTTATCAGTCATTTGTTCATGCAGCTGGGA
ACTGTGGGGATATATGATTTGCCACATCTGAGGAACAAACTGGCCATGAACAGACGTTGG
GGC
Restriction Sites Please inquire     
ACCN NM_001114173
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001114173.1, NP_001107645.1
RefSeq Size 6099 bp
RefSeq ORF 426 bp
Locus ID 1075
UniProt ID P53634
Protein Families Druggable Genome, Protease
Protein Pathways Lysosome
Gene Summary This gene encodes a member of the peptidase C1 family and lysosomal cysteine proteinase that appears to be a central coordinator for activation of many serine proteinases in cells of the immune system. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate heavy and light chains that form a disulfide-linked dimer. A portion of the propeptide acts as an intramolecular chaperone for the folding and stabilization of the mature enzyme. This enzyme requires chloride ions for activity and can degrade glucagon. Defects in the encoded protein have been shown to be a cause of Papillon-Lefevre syndrome, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (3) differs in the coding sequence and 3' UTR compared to variant 1. This results in an isoform (c) that is much shorter and contains a different C-terminus than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...