United States
Germany
Japan
United Kingdom
China
BCL2A1 (NM_001114735) Human Untagged Clone
CAT＃: SC318782
BCL2A1 (untagged)-Human BCL2-related protein A1 (BCL2A1), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACC-1; ACC-2; ACC1; ACC2; BCL2L5; BFL1; GRS; HBPA1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC318782 representing NM_001114735.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAGACTGTGAATTTGGATATATTTACAGGCTGGCTCAGGACTATCTGCAGTGCGTCCTACAGATA CCACAACCTGGATCAGGTCCAAGCAAAACGTCCAGAGTGCTACAAAATGTTGCGTTCTCAGTCCAAAAA GAAGTGGAAAAGAATCTGAAGTCATGCTTGGACAATGTTAATGTTGTGTCCGTAGACACTGCCAGAACA CTATTCAACCAAGTGATGGAAAAGGAGTTTGAAGACGGCATCATTAACTGGGGAAGAATTGTAACCATA TTTGCATTTGAAGGTATTCTCATCAAGAAACTTCTACGACAGCAAATTGCCCCGGATGTGGATACCTAT AAGGAGATTTCATATTTTGTTGCGGAGTTCATAATGAATAACACAGGAGAATGGATAAGGCAAAACGGA GGCTGGGGGAAATGGCACAATCACACACCTATGCTGGTAGAGTCAGTGGCCCACAAGAAGAGGAAAATG GCTTTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001114735 |
| Insert Size | 492 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001114735.1 |
| RefSeq Size | 955 bp |
| RefSeq ORF | 492 bp |
| Locus ID | 597 |
| UniProt ID | Q16548 |
| Protein Families | Druggable Genome |
| Protein Pathways | Metabolic pathways |
| MW | 18.7 kDa |
| Gene Summary | This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators that are involved in a wide variety of cellular activities such as embryonic development, homeostasis and tumorigenesis. The protein encoded by this gene is able to reduce the release of pro-apoptotic cytochrome c from mitochondria and block caspase activation. This gene is a direct transcription target of NF-kappa B in response to inflammatory mediators, and is up-regulated by different extracellular signals, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), CD40, phorbol ester and inflammatory cytokine TNF and IL-1, which suggests a cytoprotective function that is essential for lymphocyte activation as well as cell survival. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an additional exon in the coding region, as compared to variant 1. The resulting isoform (2) has a different and shorter C-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225155 | BCL2A1 (Myc-DDK-tagged)-Human BCL2-related protein A1 (BCL2A1), transcript variant 2 |
CNY 1,200.00 |
|
| RC225155L3 | Lenti ORF clone of Human BCL2-related protein A1 (BCL2A1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225155L4 | Lenti ORF clone of Human BCL2-related protein A1 (BCL2A1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG225155 | BCL2A1 (tGFP-tagged) - Human BCL2-related protein A1 (BCL2A1), transcript variant 2 |
CNY 4,370.00 |
