BCL2A1 (NM_001114735) Human Untagged Clone

CAT#: SC318782

BCL2A1 (untagged)-Human BCL2-related protein A1 (BCL2A1), transcript variant 2



  "NM_001114735" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
BCL2A1 mouse monoclonal antibody, clone OTI3D10 (formerly 3D10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACC-1; ACC-2; ACC1; ACC2; BCL2L5; BFL1; GRS; HBPA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318782 representing NM_001114735.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAGACTGTGAATTTGGATATATTTACAGGCTGGCTCAGGACTATCTGCAGTGCGTCCTACAGATA
CCACAACCTGGATCAGGTCCAAGCAAAACGTCCAGAGTGCTACAAAATGTTGCGTTCTCAGTCCAAAAA
GAAGTGGAAAAGAATCTGAAGTCATGCTTGGACAATGTTAATGTTGTGTCCGTAGACACTGCCAGAACA
CTATTCAACCAAGTGATGGAAAAGGAGTTTGAAGACGGCATCATTAACTGGGGAAGAATTGTAACCATA
TTTGCATTTGAAGGTATTCTCATCAAGAAACTTCTACGACAGCAAATTGCCCCGGATGTGGATACCTAT
AAGGAGATTTCATATTTTGTTGCGGAGTTCATAATGAATAACACAGGAGAATGGATAAGGCAAAACGGA
GGCTGGGGGAAATGGCACAATCACACACCTATGCTGGTAGAGTCAGTGGCCCACAAGAAGAGGAAAATG
GCTTTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001114735
Insert Size 492 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001114735.1
RefSeq Size 955 bp
RefSeq ORF 492 bp
Locus ID 597
UniProt ID Q16548
Protein Families Druggable Genome
Protein Pathways Metabolic pathways
MW 18.7 kDa
Gene Summary This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators that are involved in a wide variety of cellular activities such as embryonic development, homeostasis and tumorigenesis. The protein encoded by this gene is able to reduce the release of pro-apoptotic cytochrome c from mitochondria and block caspase activation. This gene is a direct transcription target of NF-kappa B in response to inflammatory mediators, and is up-regulated by different extracellular signals, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), CD40, phorbol ester and inflammatory cytokine TNF and IL-1, which suggests a cytoprotective function that is essential for lymphocyte activation as well as cell survival. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an additional exon in the coding region, as compared to variant 1. The resulting isoform (2) has a different and shorter C-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...