p57 Kip2 (CDKN1C) (NM_001122630) Human Untagged Clone
CAT#: SC318824
CDKN1C (untagged)-Human cyclin-dependent kinase inhibitor 1C (p57, Kip2) (CDKN1C), transcript variant 2
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BWCR; BWS; KIP2; p57; p57Kip2; WBS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001122630, the custom clone sequence may differ by one or more nucleotides
ATGGAGCGTCTTGTCGCCCGTGGGACCTTCCCAGTACTAGTGCGCACCAGCGCCTGCCGC AGCCTCTTCGGGCCGGTGGACCACGAGGAGCTGAGCCGCGAGCTGCAGGCCCGCCTGGCC GAGCTGAACGCCGAGGACCAGAACCGCTGGGATTACGACTTCCAGCAGGACATGCCGCTG CGGGGCCCTGGACGCCTGCAGTGGACCGAAGTGGACAGCGACTCGGTGCCCGCGTTCTAC CGCGAGACGGTGCAGGTGGGGCGCTGCCGCCTGCTGCTGGCGCCGCGGCCCGTCGCGGTC GCGGTGGCTGTCAGCCCGCCCCTCGAGCCGGCCGCTGAGTCCCTCGACGGCCTCGAGGAG GCGCCGGAGCAGCTGCCTAGTGTCCCGGTCCCGGCCCCGGCGTCCACCCCGCCCCCAGTC CCGGTCCTGGCTCCAGCCCCGGCCCCGGCTCCGGCTCCGGTCGCGGCTCCGGTCGCGGCT CCGGTCGCGGTCGCGGTCCTGGCCCCGGCCCCGGCCCCGGCTCCGGCTCCGGCTCCGGCC CCGGCTCCAGTCGCGGCCCCGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCCGCC CCGGCCCCGGCCCCGGACGCGGCGCCTCAAGAGAGCGCCGAGCAGGGCGCGAACCAGGGG CAGCGCGGCCAGGAGCCTCTCGCTGACCAGCTGCACTCGGGGATTTCGGGACGTCCCGCG GCCGGCACCGCGGCCGCCAGCGCCAACGGCGCGGCGATCAAGAAGCTGTCCGGGCCTCTG ATCTCCGATTTCTTCGCCAAGCGCAAGAGATCAGCGCCTGAGAAGTCGTCGGGCGATGTC CCCGCGCCGTGTCCCTCTCCAAGCGCCGCCCCTGGCGTGGGCTCGGTGGAGCAGACCCCG CGCAAGAGGCTGCGG |
Restriction Sites | Please inquire |
ACCN | NM_001122630 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001122630.1, NP_001116102.1 |
RefSeq Size | 1776 bp |
RefSeq ORF | 918 bp |
Locus ID | 1028 |
UniProt ID | P49918 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle |
Gene Summary | This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225427 | CDKN1C (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 1C (p57, Kip2) (CDKN1C), transcript variant 2. Note: ORF is codon optimized |
CNY 2,400.00 |
|
RG225427 | CDKN1C (tGFP-tagged) - Human cyclin-dependent kinase inhibitor 1C (p57, Kip2) (CDKN1C), transcript variant 2. Note: ORF is codon optimized |
CNY 4,370.00 |