BLNK (NM_001114094) Human Untagged Clone

CAT#: SC318876

BLNK (untagged)-Human B-cell linker (BLNK), transcript variant 2



  "NM_001114094" in other vectors (6)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
BLNK mouse monoclonal antibody, clone OTI4C9 (formerly 4C9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGM4; BASH; bca; BLNK-S; LY57; SLP-65; SLP65
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318876 representing NM_001114094.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACAAGCTTAATAAAATAACCGTCCCCGCCAGTCAGAAGTTGAGGCAGCTTCAAAAGATGGTCCAT
GATATTAAAAACAATGAAGGTGGAATAATGAATAAAATCAAAAAGCTAAAAGTCAAAGCACCTCCAAGT
GTTCCTCGAAGGGACTACGCTTCAGAGAGCCCTGCTGACGAAGAGGAGCAGTGGTCCGATGACTTTGAC
AGCGACTATGAAAATCCAGATGAGCACTCGGACTCAGAGATGTACGTGATGCCCGCCGAGGAGAACGCT
GATGACAGCTACGAGCCGCCTCCAGTAGAGCAGGAAACCAGGCCGGTTCACCCAGCCCTGCCCTTCGCC
AGAGGCGAGTATATAGACAATCGATCAAGCCAGAGGCATTCCCCACCCTTCAGCAAGACACTTCCCAGT
AAGCCCAGCTGGCCTTCAGAGAAAGCAAGGCTCACCTCCACCCTGCCGGCCCTGACTGCTTTGCAGAAA
CCTCAAGTCCCACCCAAACCCAAAGGCCTCCTTGAGGATGAGGCTGATTATGTGGTCCCCGTGGAAGAT
AATGATGAAAACTATATTCATCCCACAGAAAGCAGTTCACCTCCACCTGAAAAAGGTCGAAACAGTGGG
GCCTGGGAAACCAAGTCACCTCCACCAGCTGCACCATCCCCGTTGCCACGGGCCGGGAAAAAACCAACG
ACACCACTGAAGACAACTCCAGTTGCCTCTCAACAGAATGCTTCAAGTGTTTGTGAAGAAAAACCTATA
CCTGCTGAACGCCACCGAGGGTCAAGTCACAGACAAGAAGCTGTGCAGTCACCAGTGTTTCCTCCTGCC
CAGAAACAAATCCACCAAAAACCCATACCTCTGCCAAGATTTACAGAAGGGGGAAACCCAACTGTGGAT
GGGCCCCTACCCAGCTTTTCATCTAATTCCACTATTTCAGAACAGGAAGCTGGCGTTCTCTGCAAGCCA
TGGTATGCTGGAGCCTGTGATCGAAAGTCTGCTGAAGAGGCATTGCACAGATCAAACAAGGATGGATCA
TTTCTTATTCGGAAAAGCTCTGGCCATGATTCCAAACAACCATATACACTAGTTGTATTCTTTAATAAG
CGAGTATATAATATTCCTGTGCGATTTATTGAAGCAACAAAACAATATGCCTTGGGCAGAAAGAAAAAT
GGTGAAGAGTACTTTGGAAGTGTTGCTGAAATCATCAGGAATCATCAACATAGTCCTTTGGTTCTTATT
GACAGTCAGAATAACACAAAAGATTCCACCAGACTGAAGTATGCAGTTAAAGTTTCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001114094
Insert Size 1302 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001114094.1
RefSeq Size 1760 bp
RefSeq ORF 1302 bp
Locus ID 29760
UniProt ID Q8WV28
Protein Families Druggable Genome
Protein Pathways B cell receptor signaling pathway, Primary immunodeficiency
MW 48.2 kDa
Gene Summary This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (2) lacks an in-frame exon in the mid-coding region compared to variant 1, resulting in a shorter isoform (2, also known as BLNK-s) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...