p63 (TP63) (NM_001114981) Human Untagged Clone
CAT#: SC318894
TP63 (untagged)-Human tumor protein p63 (TP63), transcript variant 5
CNY 3,656.00
CNY 7,320.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene ORF sequence for NM_001114981 edited
ATGTTGTACCTGGAAAACAATGCCCAGACTCAATTTAGTGAGCCACAGTACACGAACCTG GGGCTCCTGAACAGCATGGACCAGCAGATTCAGAACGGCTCCTCGTCCACCAGTCCCTAT AACACAGACCACGCGCAGAACAGCGTCACGGCGCCCTCGCCCTACGCACAGCCCAGCTCC ACCTTCGATGCTCTCTCTCCATCACCCGCCATCCCCTCCAACACCGACTACCCAGGCCCG CACAGTTTCGACGTGTCCTTCCAGCAGTCGAGCACCGCCAAGTCGGCCACCTGGACGTAT TCCACTGAACTGAAGAAACTCTACTGCCAAATTGCAAAGACATGCCCCATCCAGATCAAG GTGATGACCCCACCTCCTCAGGGAGCTGTTATCCGCGCCATGCCTGTCTACAAAAAAGCT GAGCACGTCACGGAGGTGGTGAAGCGGTGCCCCAACCATGAGCTGAGCCGTGAATTCAAC GAGGGACAGATTGCCCCTCCTAGTCATTTGATTCGAGTAGAGGGGAACAGCCATGCCCAG TATGTAGAAGATCCCATCACAGGAAGACAGAGTGTGCTGGTACCTTATGAGCCACCCCAG GTTGGCACTGAATTCACGACAGTCTTGTACAATTTCATGTGTAACAGCAGTTGTGTTGGA GGGATGAACCGCCGTCCAATTTTAATCATTGTTACTCTGGAAACCAGAGATGGGCAAGTC CTGGGCCGACGCTGCTTTGAGGCCCGGATCTGTGCTTGCCCAGGAAGAGACAGGAAGGCG GATGAAGATAGCATCAGAAAGCAGCAAGTTTCGGACAGTACAAAGAACGGTGATGGTACG AAGCGCCCGTTTCGTCAGAACACACATGGTATCCAGATGACATCCATCAAGAAACGAAGA TCCCCAGATGATGAACTGTTATACTTACCAGTGAGGGGCCGTGAGACTTATGAAATGCTG TTGAAGATCAAAGAGTCCCTGGAACTCATGCAGTACCTTCCTCAGCACACAATTGAAACG TACAGGCAACAGCAACAGCAGCAGCACCAGCACTTACTTCAGAAACAGACCTCAATACAG TCTCCATCTTCATATGGTAACAGCTCCCCACCTCTGAACAAAATGAACAGCATGAACAAG CTGCCTTCTGTGAGCCAGCTTATCAACCCTCAGCAGCGCAACGCCCTCACTCCTACAACC ATTCCTGATGGCATGGGAGCCAACATTCCCATGATGGGCACCCACATGCCAATGGCTGGA GACATGAATGGACTCAGCCCCACCCAGGCACTCCCTCCCCCACTCTCCATGCCATCCACC TCCCACTGCACACCCCCACCTCCGTATCCCACAGATTGCAGCATTGTCAGGATCTGGCAA GTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001114981 |
Insert Size | 1400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001114981.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001114981.1, NP_001108453.1 |
RefSeq Size | 4603 bp |
RefSeq ORF | 1386 bp |
Locus ID | 8626 |
UniProt ID | Q9H3D4 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a member of the p53 family of transcription factors. The functional domains of p53 family proteins include an N-terminal transactivation domain, a central DNA-binding domain and an oligomerization domain. Alternative splicing of this gene and the use of alternative promoters results in multiple transcript variants encoding different isoforms that vary in their functional properties. These isoforms function during skin development and maintenance, adult stem/progenitor cell regulation, heart development and premature aging. Some isoforms have been found to protect the germline by eliminating oocytes or testicular germ cells that have suffered DNA damage. Mutations in this gene are associated with ectodermal dysplasia, and cleft lip/palate syndrome 3 (EEC3); split-hand/foot malformation 4 (SHFM4); ankyloblepharon-ectodermal defects-cleft lip/palate; ADULT syndrome (acro-dermato-ungual-lacrimal-tooth); limb-mammary syndrome; Rap-Hodgkin syndrome (RHS); and orofacial cleft 8. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (5) differs in the 5' UTR and coding region, and also lacks an exon in the 3' coding region that results in a frameshift, compared to variant 1. The resulting isoform (5, also known as deltaNp63beta, P51delNbeta, and deltaN-beta) is shorter and has distinct N- and C-termini, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225779 | TP63 (Myc-DDK-tagged)-Human tumor protein p63 (TP63), transcript variant 5 |
CNY 3,656.00 |
|
RC225779L1 | Lenti ORF clone of Human tumor protein p63 (TP63), transcript variant 5, Myc-DDK-tagged |
CNY 5,990.00 |
|
RC225779L2 | Lenti ORF clone of Human tumor protein p63 (TP63), transcript variant 5, mGFP tagged |
CNY 5,990.00 |
|
RC225779L3 | Lenti ORF clone of Human tumor protein p63 (TP63), transcript variant 5, Myc-DDK-tagged |
CNY 5,990.00 |
|
RC225779L4 | Lenti ORF clone of Human tumor protein p63 (TP63), transcript variant 5, mGFP tagged |
CNY 5,990.00 |
|
RG225779 | TP63 (tGFP-tagged) - Human tumor protein p63 (TP63), transcript variant 5 |
CNY 4,470.00 |