United States
Germany
Japan
United Kingdom
China
Galactosidase alpha (GLA) (NM_000169) Human Untagged Clone
CAT＃: SC319065
GLA (untagged)-Human galactosidase, alpha (GLA)
CNY 5,488.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GALA |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_000169.2
GTGACAATGCAGCTGAGGAACCCAGAACTACATCTGGGCTGCGCGCTTGCGCTTCGCTTC
CTGGCCCTCGTTTCCTGGGACATCCCTGGGGCTAGAGCACTGGACAATGGATTGGCAAGG ACGCCTACCATGGGCTGGCTGCACTGGGAGCGCTTCATGTGCAACCTTGACTGCCAGGAA GAGCCAGATTCCTGCATCAGTGAGAAGCTCTTCATGGAGATGGCAGAGCTCATGGTCTCA GAAGGCTGGAAGGATGCAGGTTATGAGTACCTCTGCATTGATGACTGTTGGATGGCTCCC CAAAGAGATTCAGAAGGCAGACTTCAGGCAGACCCTCAGCGCTTTCCTCATGGGATTCGC CAGCTAGCTAATTATGTTCACAGCAAAGGACTGAAGCTAGGGATTTATGCAGATGTTGGA AATAAAACCTGCGCAGGCTTCCCTGGGAGTTTTGGATACTACGACATTGATGCCCAGACC TTTGCTGACTGGGGAGTAGATCTGCTAAAATTTGATGGTTGTTACTGTGACAGTTTGGAA AATTTGGCAGATGGTTATAAGCACATGTCCTTGGCCCTGAATAGGACTGGCAGAAGCATT GTGTACTCCTGTGAGTGGCCTCTTTATATGTGGCCCTTTCAAAAGCCCAATTATACAGAA ATCCGACAGTACTGCAATCACTGGCGAAATTTTGCTGACATTGATGATTCCTGGAAAAGT ATAAAGAGTATCTTGGACTGGACATCTTTTAACCAGGAGAGAATTGTTGATGTTGCTGGA CCAGGGGGTTGGAATGACCCAGATATGTTAGTGATTGGCAACTTTGGCCTCAGCTGGAAT CAGCAAGTAACTCAGATGGCCCTCTGGGCTATCATGGCTGCTCCTTTATTCATGTCTAAT GACCTCCGACACATCAGCCCTCAAGCCAAAGCTCTCCTTCAGGATAAGGACGTAATTGCC ATCAATCAGGACCCCTTGGGCAAGCAAGGGTACCAGCTTAGACAGGGAGACAACTTTGAA GTGTGGGAACGACCTCTCTCAGGCTTAGCCTGGGCTGTAGCTATGATAAACCGGCAGGAG ATTGGTGGACCTCGCTCTTATACCATCGCAGTTGCTTCCCTGGGTAAAGGAGTGGCCTGT AATCCTGCCTGCTTCATCACACAGCTCCTCCCTGTGAAAAGGAAGCTAGGGTTCTATGAA TGGACTTCAAGGTTAAGAAGTCACATAAATCCCACAGGCACTGTTTTGCTTCAGCTAGAA AATACAATGCAGATGTCATTAAAAGACTTACTTTAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_000169 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000169.2, NP_000160.1 |
| RefSeq Size | 1418 bp |
| RefSeq ORF | 1290 bp |
| Locus ID | 2717 |
| UniProt ID | P06280 |
| Domains | Melibiase |
| Protein Families | Druggable Genome |
| Protein Pathways | Galactose metabolism, Glycerolipid metabolism, Glycosphingolipid biosynthesis - globo series, Lysosome, Sphingolipid metabolism |
| Gene Summary | This gene encodes a homodimeric glycoprotein that hydrolyses the terminal alpha-galactosyl moieties from glycolipids and glycoproteins. This enzyme predominantly hydrolyzes ceramide trihexoside, and it can catalyze the hydrolysis of melibiose into galactose and glucose. A variety of mutations in this gene affect the synthesis, processing, and stability of this enzyme, which causes Fabry disease, a rare lysosomal storage disorder that results from a failure to catabolize alpha-D-galactosyl glycolipid moieties. [provided by RefSeq, Jul 2008] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Drug Repositioning for Fabry Disease: Acetylsalicylic Acid Potentiates the Stabilization of Lysosomal Alpha-Galactosidase by Pharmacological Chaperones
,null,
International Journal of Molecular Sciences
,PubMed ID 35563496
[GLA]
|
|
A thermodynamic assay to test pharmacological chaperones for Fabry disease
,Andreotti, G;Citro, V;Correra, A;Cubellis, MV;,
Biochim. Biophys. Acta Dec 2013.
,PubMed ID 24361605
[GLA]
|
|
Therapy of Fabry disease with pharmacological chaperones: from in silico predictions to in vitro tests
,null,
Orphanet Journal of Rare Diseases
,PubMed ID 22004918
[GLA]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201304 | GLA (Myc-DDK-tagged)-Human galactosidase, alpha (GLA) |
CNY 5,488.00 |
|
| RC201304L1 | Lenti ORF clone of Human galactosidase, alpha (GLA), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC201304L2 | Lenti ORF clone of Human galactosidase, alpha (GLA), mGFP tagged |
CNY 7,888.00 |
|
| RC201304L3 | Lenti ORF clone of Human galactosidase, alpha (GLA), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC201304L4 | Lenti ORF clone of Human galactosidase, alpha (GLA), mGFP tagged |
CNY 7,888.00 |
|
| RG201304 | GLA (tGFP-tagged) - Human galactosidase, alpha (GLA) |
CNY 7,088.00 |
其它Galactosidase alpha产品
