United States
Germany
Japan
United Kingdom
China
SDHB (NM_003000) Human Untagged Clone
CAT＃: SC319204
SDHB (untagged)-Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein
CNY 2,400.00
CNY 6,270.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CWS2; IP; MC2DN4; PGL4; SDH; SDH1; SDH2; SDHIP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003000.2
ACCCGGGAAACCGGAAGCCGCCTCCCACTTGGTTGCTCGTACGCGGCTAGTGGGTCCTCA
GTGGATGTAGGCTGGGCGCCGCGATGTTCGACGGGACACCGGCGGAGAGCGACCTCGGGG TTAAGGGGTGGGGCTGACGTCAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAG GCGCCGGTTGCCGGCCACAACCCTTGGCGGAGCCTGCCTGCAGGCCTCCCGAGGAGCCCA GACAGCTGCAGCCACAGCTCCCCGTATCAAGAAATTTGCCATCTATCGATGGGACCCAGA CAAGGCTGGAGACAAACCTCATATGCAGACTTATGAAGTTGACCTTAATAAATGTGGCCC CATGGTATTGGATGCTTTAATCAAGATTAAGAATGAAGTTGACTCTACTTTGACCTTCCG AAGATCATGCAGAGAAGGCATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACAC TCTAGCTTGCACCCGAAGGATTGACACCAACCTCAATAAGGTCTCAAAAATCTACCCTCT TCCACACATGTATGTGATAAAGGATCTTGTTCCCGATTTGAGCAACTTCTATGCACAGTA CAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCTCAGGAAGGCAAGCAGCAGTA TCTGCAGTCCATAGAAGAGCGTGAGAAACTGGACGGGCTCTACGAGTGCATTCTCTGTGC CTGCTGTAGCACCAGCTGCCCCAGCTACTGGTGGAACGGAGACAAATATCTGGGGCCTGC AGTTCTTATGCAGGCCTATCGCTGGATGATTGACTCCAGAGATGACTTCACAGAGGAGCG CCTGGCCAAGCTGCAGGACCCATTCTCTCTATACCGCTGCCACACCATCATGAACTGCAC AAGGACCTGTCCTAAGGGTCTGAATCCAGGGAAAGCTATTGCAGAGATCAAGAAAATGAT GGCAACCTATAAGGAGAAGAAAGCTTCAGTTTAACTGTTTCCATGCTAAACATGATTTAT AACCAGCTCAGAGCTGAACATAATTTATATCTAATTTGAGTTCCTTTAAAGATCTTGGTT TTCCATGAATACAGCATGTATAATAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_003000 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003000.2, NP_002991.2 |
| RefSeq Size | 1161 bp |
| RefSeq ORF | 843 bp |
| Locus ID | 6390 |
| UniProt ID | P21912 |
| Domains | fer2 |
| Protein Families | Druggable Genome |
| Protein Pathways | Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
| Gene Summary | Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
APOBEC3A cytidine deaminase induces RNA editing in monocytes and macrophages
,Sharma, S;Patnaik, SK;Thomas Taggart, R;Kannisto, ED;Enriquez, SM;Gollnick, P;Baysal, BE;,
Nat Commun
,PubMed ID 25898173
[SDHB]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203182 | SDHB (Myc-DDK-tagged)-Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
| RC203182L1 | Lenti ORF clone of Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC203182L2 | Lenti ORF clone of Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 4,800.00 |
|
| RC203182L3 | Lenti ORF clone of Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC203182L4 | Lenti ORF clone of Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 4,800.00 |
|
| RG203182 | SDHB (tGFP-tagged) - Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein |
CNY 4,000.00 |
