United States
Germany
Japan
United Kingdom
China
HSP27 (HSPB1) (NM_001540) Human Untagged Clone
CAT＃: SC319285
HSPB1 (untagged)-Human heat shock 27kDa protein 1 (HSPB1)
CNY 3,600.00
| Cited in 3 publications. |
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CMT2F; HEL-S-102; HMN2B; HS.76067; Hsp25; HSP27; HSP28; SRP27 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001540.2
CCGCCTGCTAAAAATACCCGACTGGAGGAGCATAAAAGCGCAGCCGAGCCCAGCGCCCCG
CACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCC TTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGC CTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGGTTAGGC GGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCCGCCGCCATCGAGAGCCCCGCA GTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAG ATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCCCCGGAC GAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGG CAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGT GTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCC CCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCG CGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGC CTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGT GTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCACCCCCCAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001540 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001540.2, NP_001531.1 |
| RefSeq Size | 865 bp |
| RefSeq ORF | 618 bp |
| Locus ID | 3315 |
| UniProt ID | P04792 |
| Domains | HSP20 |
| Protein Pathways | MAPK signaling pathway, VEGF signaling pathway |
| Gene Summary | This gene encodes a member of the small heat shock protein (HSP20) family of proteins. In response to environmental stress, the encoded protein translocates from the cytoplasm to the nucleus and functions as a molecular chaperone that promotes the correct folding of other proteins. This protein plays an important role in the differentiation of a wide variety of cell types. Expression of this gene is correlated with poor clinical outcome in multiple human cancers, and the encoded protein may promote cancer cell proliferation and metastasis, while protecting cancer cells from apoptosis. Mutations in this gene have been identified in human patients with Charcot-Marie-Tooth disease and distal hereditary motor neuropathy. [provided by RefSeq, Aug 2017] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A new role for heat shock factor 27 in the pathophysiology of Clostridium difficile toxin B
,Yanda, MK;Guggino, WB;Cebotaru, L;,
Am. J. Physiol. Gastrointest. Liver Physiol.
,PubMed ID 31709831
[HSPB1]
|
|
Non-native Conformers of Cystic Fibrosis Transmembrane Conductance Regulator NBD1 Are Recognized by Hsp27 and Conjugated to SUMO-2 for Degradation *
,null,
The Journal of Biological Chemistry
,PubMed ID 26627832
[HSPB1]
|
|
Silencing hsp25/hsp27 Gene Expression Augments Proteasome Activity and Increases CD8+ T-Cell–Mediated Tumor Killing and Memory Responses
,Ganachari M. Nagaraja, Punit Kaur, William Neumann, Edwina E. Asea, María A. Bausero, Gabriele Multhoff, and Alexzander Asea,
Cancer Prevention Research, Jan 2012; 5: 122 - 137.
[HSPB1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201800 | HSPB1 (Myc-DDK-tagged)-Human heat shock 27kDa protein 1 (HSPB1) |
CNY 3,600.00 |
|
| RC201800L1 | Lenti ORF clone of Human heat shock 27kDa protein 1 (HSPB1), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC201800L2 | Lenti ORF clone of Human heat shock 27kDa protein 1 (HSPB1), mGFP tagged |
CNY 5,890.00 |
|
| RC201800L3 | Lenti ORF clone of Human heat shock 27kDa protein 1 (HSPB1), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC201800L4 | Lenti ORF clone of Human heat shock 27kDa protein 1 (HSPB1), mGFP tagged |
CNY 6,000.00 |
|
| RG201800 | HSPB1 (tGFP-tagged) - Human heat shock 27kDa protein 1 (HSPB1) |
CNY 5,200.00 |
