CREB3 (NM_006368) Human Untagged Clone
CAT#: SC319314
CREB3 (untagged)-Human cAMP responsive element binding protein 3 (CREB3)
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LUMAN; LZIP; sLZIP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006368.4
GTGGATAGGTGCCCGAGGCCTACAGCTGGCCTGGGGCTCGTGTCTGGGCTTCGGACGTTG
GGGCCCGGTGGCCCACCCTTTCCGTAGTTGTCCCAAATGGAGCTGGAATTGGATGCTGGT GACCAAGACCTGCTGGCCTTCCTGCTAGAGGAAAGTGGAGATTTGGGGACGGCACCCGAT GAGGCCGTGAGGGCCCCACTGGACTGGGCGCTGCCGCTTTCTGAGGTACCGAGCGACTGG GAAGTAGATGATTTGCTGTGCTCCCTGCTGAGTCCCCCAGCGTCGTTGAACATTCTCAGC TCCTCCAACCCCTGCCTTGTCCACCATGACCACACCTACTCCCTCCCACGGGAAACTGTC TCTATGGATCTAGAGAGTGAGAGCTGTAGAAAAGAGGGGACCCAGATGACTCCACAGCAT ATGGAGGAGCTGGCAGAGCAGGAGATTGCTAGGCTAGTACTGACAGATGAGGAGAAGAGT CTATTGGAGAAGGAGGGGCTTATTCTGCCTGAGACACTTCCTCTCACTAAGACAGAGGAA CAAATTCTGAAACGTGTGCGGAGGAAGATTCGAAATAAAAGATCTGCTCAAGAGAGCCGC AGGAAAAAGAAGGTGTATGTTGGGGGTTTAGAGAGCAGGGTCTTGAAATACACAGCCCAG AATATGGAGCTTCAGAACAAAGTACAGCTTCTGGAGGAACAGAATTTGTCCCTTCTAGAT CAACTGAGGAAACTCCAGGCCATGGTGATTGAGATATCAAACAAAACCAGCAGCAGCAGC ACCTGCATCTTGGTCCTACTAGTCTCCTTCTGCCTCCTCCTTGTACCTGCTATTTACTCC TCTGACACAAGGGGGAGCCTGCCAGCTGAGCATGGAGTGTTGTCCCGCCAGCTTCGTGCC CTCCCCAGTGAGGACCCTTACCAGCTGGAGCTGCCTGCCCTGCAGTCAGAAGTGCCGAAA GACAGCACACACCAGTGGTTGGACGGCTCAGACTGTGTACTCCAGGCCCCTGGCAACACT TCCTGCCTGCTGCATTACATGCCTCAGGCTCCCAGTGCAGAGCCTCCCCTGGAGTGGCCA TTCCCTGACCTCTTCTCAGAGCCTCTCTGCCGAGGTCCCATCCTCCCCCTGCAGGCAAAT CTCACAAGGAAGGGAGGATGGCTTCCTACTGGTAGCCCCTCTGTCATTTTGCAGGACAGA TACTCAGGCTAGATATGAGGATATGTGGGGGGTCTCAGCAGGAGCCTGGGGGGCTCCCCA TCTGTGTCCAAATAAAAAGCGGTGGGCAAGGGCTGGCCGCAGCTCCTGTGCCCTGTCAGG ACGACTGAGGGCTCAAACACACCACAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006368 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006368.4, NP_006359.3 |
RefSeq Size | 1868 bp |
RefSeq ORF | 1116 bp |
Locus ID | 10488 |
UniProt ID | O43889 |
Domains | BRLZ |
Protein Families | Transcription Factors |
Protein Pathways | Huntington's disease, Melanogenesis, Prostate cancer |
Gene Summary | This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.[provided by RefSeq, Nov 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203489 | CREB3 (Myc-DDK-tagged)-Human cAMP responsive element binding protein 3 (CREB3) |
CNY 3,656.00 |
|
RC203489L1 | Lenti ORF clone of Human cAMP responsive element binding protein 3 (CREB3), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC203489L2 | Lenti ORF clone of Human cAMP responsive element binding protein 3 (CREB3), mGFP tagged |
CNY 5,890.00 |
|
RC203489L3 | Lenti ORF clone of Human cAMP responsive element binding protein 3 (CREB3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203489L4 | Lenti ORF clone of Human cAMP responsive element binding protein 3 (CREB3), mGFP tagged |
CNY 5,890.00 |
|
RG203489 | CREB3 (tGFP-tagged) - Human cAMP responsive element binding protein 3 (CREB3) |
CNY 5,256.00 |