United States
Germany
Japan
United Kingdom
China
beta Actin (ACTB) (NM_001101) Human Untagged Clone
CAT＃: SC319328
ACTB (untagged)-Human actin, beta (ACTB)
CNY 3,656.00
| Cited in 13 publications. |
Product images
CNY 300.00
CNY 1,430.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BRWS1; PS1TP5BP1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001101.2
ACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACC
CGCCGCCAGCTCACCATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGC ATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTG GGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGC GACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATC GTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGT GTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAAC CGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCT ATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCC GGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATC CTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAG CGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAG CTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCC CTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTC CGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCAC GAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCC AACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAG GAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGC AAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATG TGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTC TAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTTGCGCAGA AAACAAGATGAGATTGGCATGGCTTTATTTGTTTTTTTTGTTTTGTTTTGGTTTTTTTTT TTTTTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTT GGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTT TTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAA AAGCCACCCCACTTCTCTCTAAGGAGAATGGCCCAGTCCTCTCCCAAGTCCACACAGGGG AGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTT AATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCCTTCCCCCTT TTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGC AGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCACACCTTAAAA AAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001101 |
| Insert Size | 1128 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001101.2, NP_001092.1 |
| RefSeq Size | 1793 bp |
| RefSeq ORF | 1128 bp |
| Locus ID | 60 |
| UniProt ID | P60709 |
| Domains | ACTIN |
| Protein Families | ES Cell Differentiation/IPS |
| Protein Pathways | Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Focal adhesion, Hypertrophic cardiomyopathy (HCM), Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton, Tight junction, Vibrio cholerae infection, Viral myocarditis |
| Gene Summary | This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins that are ubiquitously expressed. Mutations in this gene cause Baraitser-Winter syndrome 1, which is characterized by intellectual disability with a distinctive facial appearance in human patients. Numerous pseudogenes of this gene have been identified throughout the human genome. [provided by RefSeq, Aug 2017] |
Citations (13)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
E2F1‐activated SPIN1 promotes tumor growth via a MDM2‐p21‐E2F1 feedback loop in gastric cancer
,null,
Molecular Oncology
,PubMed ID 32767629
[ACTB]
|
|
Overexpression miR-486-3p Promoted by Allicin Enhances Temozolomide Sensitivity in Glioblastoma Via Targeting MGMT
,null,
Neuromolecular Medicine
,PubMed ID 32086739
[ACTB]
|
|
Dual actions of norathyriol as a new candidate hypouricaemic agent: uricosuric effects and xanthine oxidase inhibition.
,null,
European journal of pharmacology
,PubMed ID 31009635
[ACTB]
|
|
Comparative Visualization of the RNA Suboptimal Conformational Ensemble In Vivo
,null,
Biophysical Journal
,PubMed ID 28625696
[ACTB]
|
|
Inhibition of cyclooxygenase-2-mediated matriptase activation contributes to the suppression of prostate cancer cell motility and metastasis.
,null,
Oncogene
,PubMed ID 28368394
[ACTB]
|
|
Effect of photodynamic therapy combined with torasemide on the expression of matrix metalloproteinase 2 and sodium-potassium-chloride cotransporter 1 in rat peritumoral edema and glioma
,null,
Oncology Letters
,PubMed ID 26998126
[ACTB]
|
|
Up-regulation of the human-specific CHRFAM7A gene in inflammatory bowel disease
,null,
BBA Clinical
,PubMed ID 27051591
[ACTB]
|
|
Inducing iron deficiency improves erythropoiesis and photosensitivity in congenital erythropoietic porphyria
,Egan, DN;Yang, Z;Phillips, J;Abkowitz, JL;,
Blood
,PubMed ID 25972160
[ACTB]
|
|
Annexin A2 in renal cell carcinoma: expression, function, and prognostic significance.
,null,
Urologic oncology
,PubMed ID 25284003
[ACTB]
|
|
Rapamycin Regulates Stearoyl CoA Desaturase 1 Expression in Breast Cancer
,David Luyimbazi, Argun Akcakanat, Priscilla F. McAuliffe, Li Zhang, Gopal Singh, Ana Maria Gonzalez-Angulo, Huiqin Chen, Kim-Anh Do, Yuhuan Zheng, Mien-Chie Hung, Gordon B. Mills, and Funda Meric-Bernstam,
Mol. Cancer Ther., Oct 2010; 9: 2770 - 2784
[ACTB]
|
|
Mammalian Lass6 and its related family members regulate synthesis of specific ceramides
,null,
,PubMed ID 15823095
[ACTB]
|
|
Two Genes That Map to the STSL Locus Cause Sitosterolemia: Genomic Structure and Spectrum of Mutations Involving Sterolin-1 and Sterolin-2, Encoded by ABCG5 and ABCG8, Respectively
,null,
American Journal of Human Genetics
,PubMed ID 11452359
[ACTB]
|
|
Altered podocyte structure in GLEPP1(Ptpro)-deficient mice associated with hypertension and low glomerular filtration rate
,Bryan L. Wharram,Meera Goyal,Patrick J. Gillespie,Jocelyn E. Wiggins,David B. Kershaw,Lawrence B. Holzman,Robert C. Dysko,Thomas L. Saunders,Linda C. Samuelson,and Roger C. Wiggins,
J. Clin. Invest. 106:1281–1290 (2000)
[ACTB]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203643 | ACTB (Myc-DDK-tagged)-Human actin, beta (ACTB) |
CNY 3,656.00 |
|
| RC203643L1 | Lenti ORF clone of Human actin, beta (ACTB), Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC203643L2 | Lenti ORF clone of Human actin, beta (ACTB), mGFP tagged |
CNY 5,890.00 |
|
| RC203643L3 | Lenti ORF clone of Human actin, beta (ACTB), Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC203643L4 | Lenti ORF clone of Human actin, beta (ACTB), mGFP tagged |
CNY 6,056.00 |
|
| RG203643 | ACTB (tGFP-tagged) - Human actin, beta (ACTB) |
CNY 5,256.00 |
其它beta Actin产品
