Geminin (GMNN) (NM_015895) Human Untagged Clone
CAT#: SC319331
GMNN (untagged)-Human geminin, DNA replication inhibitor (GMNN)
CNY 2,400.00
CNY 2,950.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Gem; MGORS6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_015895.3
GTTCGGAGCGGGCGAGCGGAGTTAGCAGGGCTTTACTGCAGAGCGCGCCGGGCACTCCAG
CGACCGTGGGGATCAGCGTAGGTGAGCTGTGGCCTTTTGCGAGGTGCTGCAGCCATAGCT ACGTGCGTTCGCTACGAGGATTGAGCGTCTCCACCCAGTAAGTGGGCAAGAGGCGGCAGG AAGTGGGTACGCAGGGGCGCAAGGCGCACAGCCTCTAGACGACTCGCTTTCCCTCCGGCC AACCTCTGAAGCCGCGTCCTACTTTGACAGCTGCAGGGCCGCGGCCTGGTCTTCTGTGCT TCACCATCTACATAATGAATCCCAGTATGAAGCAGAAACAAGAAGAAATCAAAGAGAATA TAAAGAATAGTTCTGTCCCAAGAAGAACTCTGAAGATGATTCAGCCTTCTGCATCTGGAT CTCTTGTTGGAAGAGAAAATGAGCTGTCCGCAGGCTTGTCCAAAAGGAAACATCGGAATG ACCACTTAACATCTACAACTTCCAGCCCTGGGGTTATTGTCCCAGAATCTAGTGAAAATA AAAATCTTGGAGGAGTCACCCAGGAGTCATTTGATCTTATGATTAAAGAAAATCCATCCT CTCAGTATTGGAAGGAAGTGGCAGAAAAACGGAGAAAGGCGCTGTATGAAGCACTTAAGG AAAATGAGAAACTTCATAAAGAAATTGAACAAAAGGACAATGAAATTGCCCGCCTGAAAA AGGAGAATAAAGAACTGGCAGAAGTAGCAGAACATGTACAGTATATGGCAGAGCTAATAG AGAGACTGAATGGTGAACCTCTGGATAATTTTGAATCACTGGATAATCAGGAATTTGATT CTGAAGAAGAAACTGTTGAGGATTCTCTAGTGGAAGACTCAGAAATTGGCACGTGTGCTG AAGGAACTGTATCTTCCTCTACGGATGCAAAGCCATGTATATGAAATGCATTAATATTTG ACTGTTGAGAATTTTACTGCCGAAGTTTACCTCCACTAGTTCTTTGTAGCAGAGTACATA ACTACATAATGCCAACTCTGGAATCAAATTTCCTTGTTTGAATCCTGGGACCCTATTGCA TTAAAGTACAAATACTATGTATTTTTAATCTATGATGGTTTATGTGAATAGGATTTTCTC AGTTGTCAGCCATGACTTATGTTTATTACTAAATAAACTTCAAACTCCTGTGGAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_015895 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_015895.3, NP_056979.1 |
RefSeq Size | 1215 bp |
RefSeq ORF | 630 bp |
Locus ID | 51053 |
UniProt ID | O75496 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Gene Summary | This gene encodes a protein that plays a critical role in cell cycle regulation. The encoded protein inhibits DNA replication by binding to DNA replication factor Cdt1, preventing the incorporation of minichromosome maintenance proteins into the pre-replication complex. The encoded protein is expressed during the S and G2 phases of the cell cycle and is degraded by the anaphase-promoting complex during the metaphase-anaphase transition. Increased expression of this gene may play a role in several malignancies including colon, rectal and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and two pseudogenes of this gene are located on the short arm of chromosome 16. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3 and 4 encode the same protein. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
GEMC1 is a critical regulator of multiciliated cell differentiation
,Terré, B;Piergiovanni, G;Segura-Bayona, S;Gil-Gómez, G;Youssef, SA;Attolini, CS;Wilsch-Bräuninger, M;Jung, C;Rojas, AM;Marjanovic, M;Knobel, PA;Palenzuela, L;López-Rovira, T;Forrow, S;Huttner, WB;Valverde, MA;de Bruin, A;Costanzo, V;Stracker, TH;,
EMBO J.
,PubMed ID 26933123
[GMNN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202808 | GMNN (Myc-DDK-tagged)-Human geminin, DNA replication inhibitor (GMNN) |
CNY 2,400.00 |
|
RC202808L1 | Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC202808L2 | Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), mGFP tagged |
CNY 5,890.00 |
|
RC202808L3 | Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202808L4 | Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), mGFP tagged |
CNY 5,890.00 |
|
RG202808 | GMNN (tGFP-tagged) - Human geminin, DNA replication inhibitor (GMNN) |
CNY 4,000.00 |
其它Geminin产品