Fibrillarin (FBL) (NM_001436) Human Untagged Clone
CAT#: SC319339
FBL (untagged)-Human fibrillarin (FBL)
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FIB; FLRN; Nop1; RNU3IP1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001436.2
GCGAAAGCCCCGGACTCGTGGAGTTGTGAACGCCGCGGACTCCGGAGCCGCACAAACCAG
GGCTCGCCATGAAGCCAGGATTCAGTCCCCGTGGGGGTGGCTTTGGCGGCCGAGGGGGCT TTGGTGACCGTGGTGGTCGTGGAGGCCGAGGGGGCTTTGGCGGGGGCCGAGGTCGAGGCG GAGGCTTTAGAGGTCGTGGACGAGGAGGAGGTGGAGGCGGCGGCGGCGGTGGAGGAGGAG GAAGAGGTGGTGGAGGCTTCCATTCTGGTGGCAACCGGGGTCGTGGTCGGGGAGGAAAAA GAGGAAACCAGTCGGGGAAGAATGTGATGGTGGAGCCGCATCGGCATGAGGGTGTCTTCA TTTGTCGAGGAAAGGAAGATGCACTGGTCACCAAGAACCTGGTCCCTGGGGAATCAGTTT ATGGAGAGAAGAGAGTCTCGATTTCGGAAGGAGATGACAAAATTGAGTACCGAGCCTGGA ACCCCTTCCGCTCCAAGCTAGCAGCAGCAATCCTGGGTGGTGTGGACCAGATCCACATCA AACCGGGGGCTAAGGTTCTCTACCTCGGGGCTGCCTCGGGCACCACGGTCTCCCATGTCT CTGACATCGTTGGTCCGGATGGTCTAGTCTATGCAGTCGAGTTCTCCCACCGCTCTGGCC GTGACCTCATTAACTTGGCCAAGAAGAGGACCAACATCATTCCTGTGATCGAGGATGCTC GACACCCACACAAATACCGCATGCTCATCGCAATGGTGGATGTGATCTTTGCTGATGTGG CCCAGCCAGACCAGACCCGGATTGTGGCCCTGAATGCCCACACCTTCCTGCGTAATGGAG GACACTTTGTGATTTCCATTAAGGCCAACTGCATTGACTCCACAGCCTCAGCCGAGGCCG TGTTTGCCTCCGAAGTGAAAAAGATGCAACAGGAGAACATGAAGCCGCAGGAGCAGTTGA CCCTTGAGCCATATGAAAGAGACCATGCCGTGGTCGTGGGAGTGTACAGGCCACCCCCCA AGGTGAAGAACTGAAGTTCAGCGCTGTCAGGATTGCGAGAGATGTGTGTTGATACTGTTG CACGTGTGTTTTTCTATTAAAAGACTCATCCGTCAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001436 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001436.2, NP_001427.2 |
RefSeq Size | 1135 bp |
RefSeq ORF | 966 bp |
Locus ID | 2091 |
UniProt ID | P22087 |
Domains | Fibrillarin |
Protein Families | Stem cell - Pluripotency |
Gene Summary | This gene product is a component of a nucleolar small nuclear ribonucleoprotein (snRNP) particle thought to participate in the first step in processing preribosomal RNA. It is associated with the U3, U8, and U13 small nuclear RNAs and is located in the dense fibrillar component (DFC) of the nucleolus. The encoded protein contains an N-terminal repetitive domain that is rich in glycine and arginine residues, like fibrillarins in other species. Its central region resembles an RNA-binding domain and contains an RNP consensus sequence. Antisera from approximately 8% of humans with the autoimmune disease scleroderma recognize fibrillarin. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200732 | FBL (Myc-DDK-tagged)-Human fibrillarin (FBL) |
CNY 3,600.00 |
|
RC200732L1 | Lenti ORF clone of Human fibrillarin (FBL), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC200732L2 | Lenti ORF clone of Human fibrillarin (FBL), mGFP tagged |
CNY 5,890.00 |
|
RC200732L3 | Lenti ORF clone of Human fibrillarin (FBL), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200732L4 | Lenti ORF clone of Human fibrillarin (FBL), mGFP tagged |
CNY 5,890.00 |
|
RG200732 | FBL (tGFP-tagged) - Human fibrillarin (FBL) |
CNY 5,200.00 |
其它Fibrillarin产品