United States
Germany
Japan
United Kingdom
China
CSRP3 (NM_003476) Human Untagged Clone
CAT＃: SC319349
CSRP3 (untagged)-Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CLP; CMD1M; CMH12; CRP3; LMO4; MLP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003476.2
GACTTGACCTTGACCAGATAGTCTTCAAGATGCCAAACTGGGGCGGAGGCGCAAAATGTG
GAGCCTGTGAAAAGACCGTCTACCATGCAGAAGAAATCCAGTGCAATGGAAGGAGTTTCC ACAAGACGTGTTTCCACTGCATGGCCTGCAGGAAGGCTCTTGACAGCACGACAGTCGCGG CTCATGAGTCGGAGATCTACTGCAAGGTGTGCTATGGGCGCAGATATGGCCCCAAAGGGA TCGGGTATGGACAAGGCGCTGGCTGTCTCAGCACAGACACGGGCGAGCATCTCGGCCTGC AGTTCCAACAGTCCCCAAAGCCGGCACGCTCAGTTACCACCAGCAACCCTTCCAAATTCA CTGCAAAGTTTGGAGAGTCCGAGAAGTGCCCTCGATGTGGCAAGTCAGTCTATGCTGCTG AGAAGGTTATGGGAGGTGGCAAGCCTTGGCACAAGACCTGTTTCCGCTGTGCCATCTGTG GGAAGAGTCTGGAGTCCACAAATGTCACTGACAAAGATGGGGAACTTTATTGCAAAGTTT GCTATGCCAAAAATTTTGGCCCCACGGGTATTGGGTTTGGAGGCCTTACACAACAAGTGG AAAAGAAAGAATGAAGAGGTGCGCCGTTTCTCAGATTTTTTGCGAGCCTAAAACACTTGC CAAGTAATCCTGCACAGATCGATACCTTTCCCCAAATAGCCTCTCCTTTGTAGTCGTACA TTATGTGTTTCTCCTCGGAAGTGATCAGGTCTTTACTGAATGTTAGAAGAGGCCTTTGGA AGAAAATTATGTAAAGTTTAATCTATAACAAATGCTTTATTATTTATAATGCTTGGAATG GGAGAGGCAATAAATAAATGTTTTAGTGCTATCTTGTATGGCTCTAGATCTTTTCTTTGA GATAGAAATTTTCAAAAACATAAAGCTAGTTCAAAAAACGAGTTGCAGAGCATATAATAA ATTTGGATGTCAACTGAGAAAGGAGTGAGAAGGAAGAAACAATGCGCAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_003476 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003476.2, NP_003467.1 |
| RefSeq Size | 1353 bp |
| RefSeq ORF | 585 bp |
| Locus ID | 8048 |
| UniProt ID | P50461 |
| Domains | LIM |
| Gene Summary | This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203241 | CSRP3 (Myc-DDK-tagged)-Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 1 |
CNY 2,400.00 |
|
| RC203241L1 | Lenti ORF clone of Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC203241L2 | Lenti ORF clone of Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC203241L3 | Lenti ORF clone of Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC203241L4 | Lenti ORF clone of Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG203241 | CSRP3 (tGFP-tagged) - Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 1 |
CNY 4,000.00 |
