United States
Germany
Japan
United Kingdom
China
GRB2 (NM_002086) Human Untagged Clone
CAT＃: SC319370
GRB2 (untagged)-Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1
CNY 2,400.00
CNY 2,950.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ASH; EGFRBP-GRB2; Grb3-3; MST084; MSTP084; NCKAP2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_002086.3
GACCGGGCGGCGGCAGCGGCGGCGGCGGCTGTGGCAGAGTCTGTGCCTGTGGCGGTGACG
GCGGCGGGAGCAAGCGCTGCCCTCGCAGAGCAGCCTTGGGGTCGCCGGCCGCTCGCAGCG TTGTGGAGGGGCGGGCCGGACGCTGAGCGGAGCAGCTGCGCCACGGGTGGCATTGTGTGT CCCAGAGTGCCGGAGCGAGTCCCAGAAGAGAGGCGAGGCTAAGCCCAGAGCGCTGGGTTG CTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCTGAGCACTGAGCAGCGCTCA GAATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCA AAAGGGGGGACATCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAG AGCTTAATGGAAAAGACGGCTTCATTCCCAAGAACTACATAGAAATGAAACCACATCCGT GGTTTTTTGGCAAAATCCCCAGAGCCAAGGCAGAAGAAATGCTTAGCAAACAGCGGCACG ATGGGGCCTTTCTTATCCGAGAGAGTGAGAGCGCTCCTGGGGACTTCTCCCTCTCTGTCA AGTTTGGAAACGATGTGCAGCACTTCAAGGTGCTCCGAGATGGAGCCGGGAAGTACTTCC TCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTGGATTATCACAGATCTACATCTG TCTCCAGAAACCAGCAGATATTCCTGCGGGACATAGAACAGGTGCCACAGCAGCCGACAT ACGTCCAGGCCCTCTTTGACTTTGATCCCCAGGAGGATGGAGAGCTGGGCTTCCGCCGGG GAGATTTTATCCATGTCATGGATAACTCAGACCCCAACTGGTGGAAAGGAGCTTGCCACG GGCAGACCGGCATGTTTCCCCGCAATTATGTCACCCCCGTGAACCGGAACGTCTAAGAGT CAAGAAGCAATTATTTAAAGAAAGTGAAAAATGTAAAACACATACAAAAGAATTAAACCC ACAAGCTGCCTCTGACAGCAGCCTGTGAGGGAGTGCAGAACACCTGGCCGGGTCACCCTG TGACCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATG CCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCT TTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGT TTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002086 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002086.3, NP_002077.1 |
| RefSeq Size | 3317 bp |
| RefSeq ORF | 654 bp |
| Locus ID | 2885 |
| UniProt ID | P62993 |
| Domains | SH2, SH3 |
| Protein Families | Druggable Genome |
| Protein Pathways | Acute myeloid leukemia, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Dorso-ventral axis formation, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pathways in cancer, Prostate cancer, Renal cell carcinoma, T cell receptor signaling pathway |
| Gene Summary | The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Recruitment of the Adaptor Protein Grb2 to EGFR Tetramers
,Kozer, N;Barua, D;Henderson, C;Nice, EC;Burgess, AW;Hlavacek, WS;Clayton, AH;,
Biochemistry 2594-604 53 16. April 2014
,PubMed ID 24697349
[Grb2]
|
|
The Molecular Basis of Phospholipase D2-Induced Chemotaxis: Elucidation of Differential Pathways in Macrophages and Fibroblasts
,Katie Knapek, Kathleen Frondorf, Jennalee Post, Stephen Short, Dianne Cox, and Julian Gomez-Cambronero,
Mol. Cell. Biol., Sep 2010; 30: 4492 - 4506
[Grb2]
|
|
Src-dependent TrkA Transactivation Is Required for Pituitary Adenylate Cyclase-activating Polypeptide 38-mediated Rit Activation and Neuronal Differentiation
,Geng-Xian Shi, Ling Jin, and Douglas A. Andres,
Mol. Biol. Cell, May 2010; 21: 1597 - 1608
[GRB2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200469 | GRB2 (Myc-DDK-tagged)-Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1 |
CNY 2,400.00 |
|
| RC200469L1 | Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200469L2 | Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC200469L3 | Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200469L4 | Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG200469 | GRB2 (tGFP-tagged) - Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1 |
CNY 4,000.00 |
