NADE (BEX3) (NM_206917) Human Untagged Clone
CAT#: SC319394
NGFRAP1 (untagged)-Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Bex; DXS6984E; HGR74; NADE; NGFRAP1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_206917.1
GTGCAGTCGTCACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGG
CATTCGGCCCGGGGAAAAGCGGAGCAGGTCTGCGAGGCTAAGTGTCTCCGCGGCGCACCT CGCGGCGAGAATCCGGAGGAGAAGGAGACTGCAAGGATAGGCCCAGAAAAACAACCAGAA AAAAAAAATCTCATCATGGCAAATATTCACCAGGAAAACGAAGAGATGGAGCAGCCTATG CAGAATGGAGAGGAAGACCGCCCTTTGGGAGGAGGTGAAGGCCACCAGCCTGCAGGAAAT CGACGGGGACAGGCTCGCCGACTTGCCCCTAATTTTCGATGGGCCATACCCAATAGGCAG ATCAATGATGGGATGGGTGGAGATGGAGATGATATGGAAATATTCATGGAGGAGATGAGA GAAATCAGAAGAAAACTTAGGGAGCTGCAGTTGAGGAATTGTCTGCGTATCCTTATGGGG GAGCTCTCTAATCACCATGACCATCATGATGAATTTTGCCTTATGCCTTGACTCCTGCCA TTTATCATGAGATTAATACTGTGATTCCCGCTGTTTTCTTTTTCCTTGCATTTTCCTAAT ATGCCTTTACTGATCCGTTTGCTGTGAACCCTATGTTATTTCCATGTGTCAAGTGGGTCT TGTGTTGCCAGCTTCTATTTGAAGATTGCCTTTGCACTCAGTGTAAGTTTCTGTCAGCAG TAGTTTCACCCATTTGCATGGAAAAATTTAAAGCTAATAAAGCAATTTAAAAAGCAAAAA AAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_206917 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_206917.1, NP_996800.1 |
RefSeq Size | 933 bp |
RefSeq ORF | 306 bp |
Locus ID | 27018 |
UniProt ID | Q00994 |
Protein Families | Druggable Genome |
Protein Pathways | Neurotrophin signaling pathway |
Gene Summary | May be a signaling adapter molecule involved in p75NTR-mediated apoptosis induced by NGF. Plays a role in zinc-triggered neuronal death (By similarity). May play an important role in the pathogenesis of neurogenetic diseases.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the shortest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200067 | NGFRAP1 (Myc-DDK-tagged)-Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 1 |
CNY 3,990.00 |
|
RC200067L3 | Lenti-ORF clone of NGFRAP1 (Myc-DDK-tagged)-Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 1 |
CNY 5,890.00 |
|
RC200067L4 | Lenti-ORF clone of NGFRAP1 (mGFP-tagged)-Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 1 |
CNY 5,890.00 |
|
RG200067 | NGFRAP1 (tGFP-tagged) - Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 1 |
CNY 4,370.00 |