United States
Germany
Japan
United Kingdom
China
Apolipoprotein E (APOE) (NM_000041) Human Untagged Clone
CAT＃: SC319433
APOE (untagged)-Human apolipoprotein E (APOE)
CNY 2,400.00
CNY 2,950.00
| Cited in 4 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AD2; APO-E; ApoE4; LDLCQ5; LPG |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_000041.2
GGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGG
GCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAG ACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAA CTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTG CAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACC ATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAG GAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGAC ATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGC CAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGG CTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGC GAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAG GGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCC CAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGAC CGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCC CAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCC CTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTG GGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG CGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCC CCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACG CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC |
| Restriction Sites | Please inquire |
| ACCN | NM_000041 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000041.2, NP_000032.1 |
| RefSeq Size | 1223 bp |
| RefSeq ORF | 954 bp |
| Locus ID | 348 |
| UniProt ID | P02649 |
| Domains | Apolipoprotein |
| Protein Families | Adult stem cells, Druggable Genome, Secreted Protein, Stem cell - Pluripotency |
| Protein Pathways | Alzheimer's disease |
| Gene Summary | The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. [provided by RefSeq, Jun 2016] Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b. |
Citations (4)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The mitochondrial BCKD complex interacts with hepatic apolipoprotein E in cultured cells in vitro and mouse livers in vivo
,null,
Cellular and Molecular Life Sciences
,PubMed ID 36749362
[APOE]
|
|
Influence of the APOE genotype on hepatic stress response: Studies in APOE targeted replacement mice and human liver cells
,Dose, J;Nebel, A;Piegholdt, S;Rimbach, G;Huebbe, P;,
Free Radic. Biol. Med.
,PubMed ID 27130033
[APOE]
|
|
The C-terminal {alpha}-helix domain of apolipoprotein E is required for interaction with nonstructural protein 5A and assembly of hepatitis C virus
,Wei Cun, Jieyun Jiang, and Guangxiang Luo,
J. Virol., Nov 2010; 84: 11532 - 11541
[APOE]
|
|
Human apolipoprotein E is required for Infectivity and Production of Hepatitis C Virus in Cell Culture
,Kyung-Soo Chang, Jieyun Jiang, Zhaohui Cai, and Guangxiang Luo,
J Virol. 2007 Dec;81(24):13783-93.
[APOE]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200395 | APOE (Myc-DDK-tagged)-Human apolipoprotein E (APOE) |
CNY 2,400.00 |
|
| RC200395L1 | Lenti ORF clone of Human apolipoprotein E (APOE), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200395L2 | Lenti ORF clone of Human apolipoprotein E (APOE), mGFP tagged |
CNY 5,890.00 |
|
| RC200395L3 | Lenti ORF clone of Human apolipoprotein E (APOE), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200395L4 | Lenti ORF clone of Human apolipoprotein E (APOE), mGFP tagged |
CNY 4,800.00 |
|
| RG200395 | APOE (tGFP-tagged) - Human apolipoprotein E (APOE) |
CNY 4,000.00 |
其它Apolipoprotein E产品
