CLPP (NM_006012) Human Untagged Clone
CAT#: SC319485
CLPP (untagged)-Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein
CNY 2,400.00
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNB81; PRLTS3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006012.2
CCTTAATGGCGCCCGCCCAGACTCCTGGAAGTGAGCGGCCTAGCGAGCGAGCTCCCAGGC
GCAAAGCACGCCGGAAGCTGTAGTTCCGCCATCGGACGGAAGCCGACCGGGGCGTGCGGA GGGATGTGGCCCGGAATATTGGTAGGGGGGGCCCGGGTGGCGTCATGCAGGTACCCCGCG CTGGGGCCTCGCCTCGCCGCTCACTTTCCAGCGCAGCGGCCGCCGCAGCGGACACTCCAG AACGGCCTGGCCCTGCAGCGGTGCCTGCACGCGACGGCGACCCGGGCTCTCCCGCTCATT CCCATCGTGGTGGAGCAGACGGGTCGCGGCGAGCGCGCCTATGACATCTACTCGCGGCTG CTGCGGGAGCGCATCGTGTGCGTCATGGGCCCGATCGATGACAGCGTTGCCAGCCTTGTT ATCGCACAGCTCCTCTTCCTGCAATCCGAGAGCAACAAGAAGCCCATCCACATGTACATC AACAGCCCTGGTGGTGTGGTGACCGCGGGCCTGGCCATCTACGACACGATGCAGTACATC CTCAACCCGATCTGCACCTGGTGCGTGGGCCAGGCCGCCAGCATGGGCTCCCTGCTTCTC GCCGCCGGCACCCCAGGCATGCGCCACTCGCTCCCCAACTCCCGTATCATGATCCACCAG CCCTCAGGAGGCGCCCGGGGCCAAGCCACAGACATTGCCATCCAGGCAGAGGAGATCATG AAGCTCAAGAAGCAGCTCTATAACATCTACGCCAAGCACACCAAACAGAGCCTGCAGGTG ATCGAGTCCGCCATGGAGAGGGACCGCTACATGAGCCCCATGGAGGCCCAGGAGTTTGGC ATCTTAGACAAGGTTCTGGTCCACCCTCCCCAGGACGGTGAGGATGAGCCCACGCTGGTG CAGAAGGAGCCTGTAGAAGCAGCGCCGGCAGCAGAACCTGTCCCAGCTAGCACCTGAGAG CTGGGCCTCCTCTCCAGAATCATGTGGAGGGGCCAGAGGCCTGCCAGACCCCCAGCTGGG CCCTGCTCACCCCTTGTTGCTGGGCTTGGAGGGGCCTCTTGAGGAACTTTTAATTTGCAG GGGTGCCCGCTATGGACGGGGCATTCCAGCTGAGACACTGTGATTTTAAATTAAATCTTT GTGGTCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006012 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006012.2, NP_006003.1 |
RefSeq Size | 1194 bp |
RefSeq ORF | 834 bp |
Locus ID | 8192 |
UniProt ID | Q16740 |
Domains | CLP_protease |
Protein Families | Druggable Genome, Protease |
Gene Summary | The protein encoded by this gene belongs to the peptidase family S14 and hydrolyzes proteins into small peptides in the presence of ATP and magnesium. The protein is transported into mitochondrial matrix and is associated with the inner mitochondrial membrane. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200301 | CLPP (Myc-DDK-tagged)-Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein |
CNY 3,600.00 |
|
RC200301L1 | Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC200301L2 | Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 6,000.00 |
|
RC200301L3 | Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200301L4 | Lenti ORF clone of Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 6,000.00 |
|
RG200301 | CLPP (tGFP-tagged) - Human ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (CLPP), nuclear gene encoding mitochondrial protein |
CNY 5,200.00 |