P2Y12 (P2RY12) (NM_022788) Human Untagged Clone
CAT#: SC319680
P2RY12 (untagged)-Human purinergic receptor P2Y, G-protein coupled, 12 (P2RY12), transcript variant 1
CNY 5,488.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ADPG-R; BDPLT8; HORK3; P2T(AC); P2Y(12)R; P2Y(AC); P2Y(ADP); P2Y(cyc); P2Y12; SP1999 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_022788.3
ATCACAATCAGAAGACAGGAGCTGCAGAACAGAACACTTTCTCATGTCCAGGGTCAGATT
ACAAGAGCACTCAAGACTTTACTGACGAAAACTCAGGAAATCCTCTATCACAAAGAGGTT TGGCAACTAAACTAAGACATTAAAAGGAAAATACCAGATGCCACTCTGCAGGCTGCAATA ACTACTACTTACTGGATACATTCAAACCCTCCAGAATCAACAGTTATCAGGTAACCAACA AGAAATGCAAGCCGTCGACAATCTCACCTCTGCGCCTGGGAACACCAGTCTGTGCACCAG AGACTACAAAATCACCCAGGTCCTCTTCCCACTGCTCTACACTGTCCTGTTTTTTGTTGG ACTTATCACAAATGGCCTGGCGATGAGGATTTTCTTTCAAATCCGGAGTAAATCAAACTT TATTATTTTTCTTAAGAACACAGTCATTTCTGATCTTCTCATGATTCTGACTTTTCCATT CAAAATTCTTAGTGATGCCAAACTGGGAACAGGACCACTGAGAACTTTTGTGTGTCAAGT TACCTCCGTCATATTTTATTTCACAATGTATATCAGTATTTCATTCCTGGGACTGATAAC TATCGATCGCTACCAGAAGACCACCAGGCCATTTAAAACATCCAACCCCAAAAATCTCTT GGGGGCTAAGATTCTCTCTGTTGTCATCTGGGCATTCATGTTCTTACTCTCTTTGCCTAA CATGATTCTGACCAACAGGCAGCCGAGAGACAAGAATGTGAAGAAATGCTCTTTCCTTAA ATCAGAGTTCGGTCTAGTCTGGCATGAAATAGTAAATTACATCTGTCAAGTCATTTTCTG GATTAATTTCTTAATTGTTATTGTATGTTATACACTCATTACAAAAGAACTGTACCGGTC ATACGTAAGAACGAGGGGTGTAGGTAAAGTCCCCAGGAAAAAGGTGAACGTCAAAGTTTT CATTATCATTGCTGTATTCTTTATTTGTTTTGTTCCTTTCCATTTTGCCCGAATTCCTTA CACCCTGAGCCAAACCCGGGATGTCTTTGACTGCACTGCTGAAAATACTCTGTTCTATGT GAAAGAGAGCACTCTGTGGTTAACTTCCTTAAATGCATGCCTGGATCCGTTCATCTATTT TTTCCTTTGCAAGTCCTTCAGAAATTCCTTGATAAGTATGCTGAAGTGCCCCAATTCTGC AACATCTCTGTCCCAGGACAATAGGAAAAAAGAACAGGATGGTGGTGACCCAAATGAAGA GACTCCAATGTAAACAAATTAACTAAGGAAATATTTCAATCTCTTTGTGTTCAGAACTCG TTAAAGCAAAGCGCTAAGTAAAAATATTAACTGACGAAGAAGCAACTAAGTTAATAATAA TGACTCTAAAGAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_022788 |
Insert Size | 1029 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022788.3, NP_073625.1 |
RefSeq Size | 1502 bp |
RefSeq ORF | 1029 bp |
Locus ID | 64805 |
UniProt ID | Q9H244 |
Domains | 7tm_1 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
The active metabolite of Clopidogrel disrupts P2Y12 receptor oligomers and partitions them out of lipid rafts
,Pierre Savi, Jean-Luc Zachayus, Nathalie Delesque-Touchard, Catherine Labouret, Caroline Hervé, Marie-Françoise Uzabiaga, Jean-Marie Pereillo, Jean-Michel Culouscou, Françoise Bono, Pascual Ferrara, and Jean-Marc Herbert,
PNAS, 2006, July, vol. 103 (29) pp 11069-11074
[P2RY12]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205005 | P2RY12 (Myc-DDK-tagged)-Human purinergic receptor P2Y, G-protein coupled, 12 (P2RY12), transcript variant 1 |
CNY 5,488.00 |
|
RC205005L1 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 12 (P2RY12), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC205005L2 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 12 (P2RY12), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC205005L3 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 12 (P2RY12), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC205005L4 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 12 (P2RY12), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG205005 | P2RY12 (tGFP-tagged) - Human purinergic receptor P2Y, G-protein coupled, 12 (P2RY12), transcript variant 1 |
CNY 7,088.00 |