ATP5F1E (NM_006886) Human Untagged Clone
CAT#: SC319830
ATP5E (untagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (ATP5E), nuclear gene encoding mitochondrial protein
CNY 1,200.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATP5E; ATPE; MC5DN3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_006886.2
GGGGTCTTCCGCTTCTGTGGTCTGATCTTCCTGCGGCTGAACCGCCCGGCTGAGCCGACA
TTGCCGGCGTCTTGGCGATTCGGCCCGACGAGCTCCGCTTTCGCTACAGCATGGTGGCCT ACTGGAGACAGGCTGGACTCAGCTACATCCGATACTCCCAGATCTGTGCAAAAGCAGTGA GAGATGCACTGAAGACAGAATTCAAAGCAAATGCTGAGAAGACTTCTGGCAGCAACGTAA AAATTGTGAAAGTAAAGAAGGAATAATCTACCCTGACTAAAGCTTGAAATGCTACATTTC CAAGGTGAAGATGTGTGGGCACATGTTATGGCAGATTGAAAAGGATCTCATTCCATGGGA AAAAAAAAAATCCTGTCTTGTTCATAAATTGACAATGTCAATAAATTGAAATATGGTTCA CTGTCAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006886 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006886.2, NP_008817.1 |
RefSeq Size | 417 bp |
RefSeq ORF | 156 bp |
Locus ID | 514 |
UniProt ID | P56381 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the epsilon subunit of the catalytic core. Two pseudogenes of this gene are located on chromosomes 4 and 13. Read-through transcripts that include exons from this gene are expressed from the upstream gene SLMO2.[provided by RefSeq, Mar 2011] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210456 | ATP5E (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (ATP5E), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
RC210456L1 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (ATP5E), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC210456L2 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (ATP5E), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC210456L3 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (ATP5E), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210456L4 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (ATP5E), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG210456 | ATP5E (tGFP-tagged) - Human ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (ATP5E), nuclear gene encoding mitochondrial protein |
CNY 2,800.00 |
其它ATP5F1E产品