RAB3A (NM_002866) Human Untagged Clone
CAT#: SC319905
RAB3A (untagged)-Human RAB3A, member RAS oncogene family (RAB3A)
CNY 2,400.00
CNY 2,950.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002866.3
GAGGACTGCAGGGGCCTGAGCCGCTGCTGCCGCCGCCGCCGCGCAGCCCCACATCAACGC
ACCGGGGTCCTGTCACCGCCACCGCCAAAAAAGTCACCGCCGCTAGGGTCGCCGTTGCAT CGGTGCAGGGCAAGATGGCATCCGCCACAGACTCGCGCTATGGGCAGAAGGAGTCCTCGG ATCAGAACTTCGACTACATGTTCAAGATTCTCATCATCGGCAACAGCAGCGTGGGCAAGA CGTCCTTCCTCTTCCGCTATGCTGACGACTCGTTCACGCCTGCCTTCGTCAGCACCGTGG GCATCGACTTCAAGGTCAAGACCATCTATCGCAACGACAAGAGGATCAAGCTGCAGATCT GGGACACAGCAGGGCAAGAGCGGTACCGGACCATCACCACCGCATACTACCGGGGCGCTA TGGGCTTCATCCTCATGTATGACATCACCAACGAGGAATCCTTCAATGCAGTGCAGGACT GGTCCACCCAGATCAAGACCTACTCATGGGACAATGCCCAGGTGCTGCTGGTAGGAAACA AGTGTGACATGGAGGATGAGCGGGTGGTGTCATCAGAACGTGGCCGGCAGCTAGCTGACC ACCTTGGGTTCGAGTTCTTTGAGGCAAGCGCCAAGGACAACATTAACGTCAAGCAGACCT TTGAGCGCCTGGTGGATGTCATCTGCGAGAAGATGTCCGAGTCGTTGGACACGGCGGACC CTGCGGTCACAGGCGCCAAGCAGGGCCCACAGCTCAGTGACCAGCAGGTGCCACCGCACC AGGACTGCGCCTGCTGAGAGCCATCCCACTCCCTTTCCCCTCTTCCCTGTCTTCCCCACC TTCCCCCAACTACCCGGGCCTGACCCGGCCCCTACCAGCCACGGGCACAAGACCCCTGCT CCTGACTTAGCCCGTCACCCTTATTTATTATTGTAGCTATTTATTTATTTATTGAAGATG TCCCCCAGGGGCCCAGGCTCCCCTGCCCGCCCCAAGCCCTGCCCCTCCTGTACATATAGC CCTTTCCCCACTCAGCTGTGGTGTCTCGTGGCCCCGTGAACTCACCGCTCACCCTCCTGA ACCCCCCCCCCGCCTTTTTTTAAAATTCACCCCCATCCACAGTTGTCAGTTGTGAAGAGG GGCCAGATGACACCCTAAAGCAGGCTGATCGGGCAATGGGAGGTGGCCAGGCCTGCCAGC CCCTCGGCTCTGCCGCGGTGGGCCGAGGCCGCTGTTGGGGGTTTCCCTGTGTGGACCATG GGGATCAGAGTCTGGCCTGCCAGGCTCCTCTCCCCGTTTTCTCTTTTGGTGGGGGGGTGT GCTGTGGGTATTCACCACCCTGGGACCCCCCCCCCCCCCGCCCACCAGACCTGTTCTGAC CTCATGAGTGTCAAACGTGCCCCCCAGTTCCTTAGGAGATGTCATGACAACACTACACGC ACCCAATAAAGCGAATGGACCATCAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002866 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002866.3, NP_002857.1 |
RefSeq Size | 1491 bp |
RefSeq ORF | 663 bp |
Locus ID | 5864 |
UniProt ID | P20336 |
Domains | ras, RAN, RAS, RHO, RAB |
Protein Families | Druggable Genome |
Gene Summary | Small GTP-binding protein that plays a central role in regulated exocytosis and secretion. Controls the recruitment, tethering and docking of secretory vesicles to the plasma membrane (By similarity). Upon stimulation, switches to its active GTP-bound form, cycles to vesicles and recruits effectors such as RIMS1, RIMS2, Rabphilin-3A/RPH3A, RPH3AL or SYTL4 to help the docking of vesicules onto the plasma membrane (By similarity). Upon GTP hydrolysis by GTPase-activating protein, dissociates from the vesicle membrane allowing the exocytosis to proceed (By similarity). Stimulates insulin secretion through interaction with RIMS2 or RPH3AL effectors in pancreatic beta cells (By similarity). Regulates calcium-dependent lysosome exocytosis and plasma membrane repair (PMR) via the interaction with 2 effectors, SYTL4 and myosin-9/MYH9 (PubMed:27325790). Acts as a positive regulator of acrosome content secretion in sperm cells by interacting with RIMS1 (PubMed:22248876, PubMed:30599141). Plays also a role in the regulation of dopamine release by interacting with synaptotagmin I/SYT (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Altered distribution of ATG9A and accumulation of axonal aggregates in neurons from a mouse model of AP-4 deficiency syndrome
,De Pace, R;Skirzewski, M;Damme, M;Mattera, R;Mercurio, J;Foster, AM;Cuitino, L;Jarnik, M;Hoffmann, V;Morris, HD;Han, TU;Mancini, GMS;Buonanno, A;Bonifacino, JS;,
PLoS Genet.
,PubMed ID 29698489
[RAB3A]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203973 | RAB3A (Myc-DDK-tagged)-Human RAB3A, member RAS oncogene family (RAB3A) |
CNY 2,400.00 |
|
RC203973L1 | Lenti ORF clone of Human RAB3A, member RAS oncogene family (RAB3A), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC203973L2 | Lenti ORF clone of Human RAB3A, member RAS oncogene family (RAB3A), mGFP tagged |
CNY 5,890.00 |
|
RC203973L3 | Lenti ORF clone of Human RAB3A, member RAS oncogene family (RAB3A), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC203973L4 | Lenti ORF clone of Human RAB3A, member RAS oncogene family (RAB3A), mGFP tagged |
CNY 4,800.00 |
|
RG203973 | RAB3A (tGFP-tagged) - Human RAB3A, member RAS oncogene family (RAB3A) |
CNY 4,000.00 |