United States
Germany
Japan
United Kingdom
China
AKT1 (NM_001014431) Human Untagged Clone
CAT＃: SC320238
AKT1 (untagged)-Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3
CNY 3,656.00
CNY 7,220.00
| Cited in 8 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AKT; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001014431.1
GGCGGCCGAGCACCGAGCGCTGGGCACCGGGCACCGAGCGGCGGCGGCACGCGAGGCCCG
GCCCCGAGCAGCGCCCCCGCCCGCCGCGGCCTCCAGCCCGGCCCCGCCCAGCGCCGGCCC GCGGGGATGCGGAGCGGCGGGCGCCGGAGGCCGCGGCCCGGCTAGGCCCGCGCTCGCGCC CGGACGCGGCGGCCCGAGGCTGTGGCCAGGCCAGCTGGGCTCGGGGAGCGCCAGCCTGAG AGGAGCGCGTGAGCGTCGCGGGAGCCTCGGGCACCATGAGCGACGTGGCTATTGTGAAGG AGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTCCTCC TCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTG AGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCC GGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCC ATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGACG GCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAACT CAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAACG AGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGGTGATCCTGGTGAAGG AGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGGAAGTCATCGTGGCCA AGGACGAGGTGGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCT TCCTCACAGCCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGT ACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACC GGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGA ACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTCATGCTGGACAAGGACGGGCACATTA AGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACCT TTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACGGCCGTG CAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCGGTCGCCTGCCCT TCTACAACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCATGGAGGAGATCCGCTTCC CGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTTTCAGGGCTGCTCAAGAAGGACCCCA AGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAGGAGATCATGCAGCATCGCTTCTTTG CCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGG TCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAGTTCACGGCCCAGATGATCACCA TCACACCACCTGACCAAGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACT TCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGAGGCGGCGGTGGACTGCGCTGGA CGATAGCTTGGAGGGATGGAGAGGCGGCCTCGTGCCATGATCTGTATTTAATGGTTTTTA TTTCTCGGGTGCATTTGAGAGAAGCCACGCTGTCCTCTCGAGCCCAGATGGAAAGACGTT TTTGTGCTGTGGGCAGCACCCTCCCCCGCAGCGGGGTAGGGAAGAAAACTATCCTGCGGG TTTTAATTTATTTCATCCAGTTTGTTCTCCGGGTGTGGCCTCAGCCCTCAGAACAATCCG ATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCC GGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTC ACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGAT GCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAG CCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGG GACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAAT TTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGG AAAGCCCTCCCCCTTCCCCTTCTGTGTCACAGTTCTTGGTGACTGTCCCACCGGGAGCCT CCCCCTCAGATGATCTCTCCACGGTAGCACTTGACCTTTTCGACGCTTAACCTTTCCGCT GTCGCCCCAGGCCCTCCCTGACTCCCTGTGGGGGTGGCCATCCCTGGGCCCCTCCACGCC TCCTGGCCAGACGCTGCCGCTGCCGCTGCACCACGGCGTTTTTTTACAACATTCAACTTT AGTATTTTTACTATTATAATATAATATGGAACCTTCCCTCCAAATTCTTCAATAAAAGTT GCTTTTCAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001014431 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001014431.1, NP_001014431.1 |
| RefSeq Size | 2794 bp |
| RefSeq ORF | 1443 bp |
| Locus ID | 207 |
| UniProt ID | P31749 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
| Protein Pathways | Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Melanoma, mTOR signaling pathway, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Tight junction, Toll-like receptor signaling pathway, VEGF signaling pathway |
| Gene Summary | This gene encodes one of the three members of the human AKT serine-threonine protein kinase family which are often referred to as protein kinase B alpha, beta, and gamma. These highly similar AKT proteins all have an N-terminal pleckstrin homology domain, a serine/threonine-specific kinase domain and a C-terminal regulatory domain. These proteins are phosphorylated by phosphoinositide 3-kinase (PI3K). AKT/PI3K forms a key component of many signalling pathways that involve the binding of membrane-bound ligands such as receptor tyrosine kinases, G-protein coupled receptors, and integrin-linked kinase. These AKT proteins therefore regulate a wide variety of cellular functions including cell proliferation, survival, metabolism, and angiogenesis in both normal and malignant cells. AKT proteins are recruited to the cell membrane by phosphatidylinositol 3,4,5-trisphosphate (PIP3) after phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) by PI3K. Subsequent phosphorylation of both threonine residue 308 and serine residue 473 is required for full activation of the AKT1 protein encoded by this gene. Phosphorylation of additional residues also occurs, for example, in response to insulin growth factor-1 and epidermal growth factor. Protein phosphatases act as negative regulators of AKT proteins by dephosphorylating AKT or PIP3. The PI3K/AKT signalling pathway is crucial for tumor cell survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating AKT1 which then phosphorylates and inactivates components of the apoptotic machinery. AKT proteins also participate in the mammalian target of rapamycin (mTOR) signalling pathway which controls the assembly of the eukaryotic translation initiation factor 4F (eIF4E) complex and this pathway, in addition to responding to extracellular signals from growth factors and cytokines, is disregulated in many cancers. Mutations in this gene are associated with multiple types of cancer and excessive tissue growth including Proteus syndrome and Cowden syndrome 6, and breast, colorectal, and ovarian cancers. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (3) lacks the 5' exon, but has an upstream alternate 5' exon, as compared to variant 1. Variants 1 and 3 encode the same protein. |
Citations (8)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Epigallocatechin-3-Gallate (EGCG) Suppresses Pancreatic Cancer Cell Growth, Invasion, and Migration partly through the Inhibition of Akt Pathway and Epithelial-Mesenchymal Transition: Enhanced Efficacy when Combined with Gemcitabine
,Wei, R;Penso, NEC;Hackman, RM;Wang, Y;Mackenzie, GG;,
Nutrients
,PubMed ID 31405071
[AKT1]
|
|
The enhancement of combination of berberine and metformin in inhibition of DNMT1 gene expression through interplay of SP1 and PDPK1
,Zheng, F;Wu, J;Tang, Q;Xiao, Q;Wu, W;Hann, SS;,
J. Cell. Mol. Med.
,PubMed ID 28840963
[AKT1]
|
|
Chinese herbal medicine Fuzheng Kang-Ai decoction sensitized the effect of gefitinib on inhibition of human lung cancer cells through inactivating PI3-K/Akt-mediated
,Li, L;Wang, SM;Zheng, F;Wu, WY;Hann, SS;,
Journal of Ethnopharmacology
,PubMed ID 27989877
[AKT1]
|
|
Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells
,Chen, Y;Tang, Q;Wu, J;Zheng, F;Yang, L;Hann, SS;,
J. Exp. Clin. Cancer Res.
,PubMed ID 26689593
[AKT1]
|
|
Plasma membrane translocation of REDD1 governed by GPCRs contributes to mTORC1 activation
,Michel, G;Matthes, HW;Hachet-Haas, M;El Baghdadi, K;de Mey, J;Pepperkok, R;Simpson, JC;Galzi, JL;Lecat, S;,
J. Cell. Sci. Dec 2013.
,PubMed ID 24338366
[AKT1]
|
|
Extrinsic sphingosine 1-phosphate activates S1P5 and induces autophagy through generating endoplasmic reticulum stress in human prostate cancer PC-3 cells
,Huang, YL;Chang, CL;Tang, CH;Lin, YC;Ju, TK;Huang, WP;Lee, H;,
Cell. Signal. Dec 2013.
,PubMed ID 24333325
[AKT1]
|
|
Akt plays a critical role in replication of non-segmented negative stranded RNA viruses
,Sun M, Fuentes SM, Timani K, Sun D, Murphy C, Lin Y, August A, Teng MN, He B.,
J Virol. 2008 Jan;82(1):105-14.
[AKT1]
|
|
Protection from angiotensin II–mediated vasculotoxic and hypertensive response in mice lacking PI3K gamma
,Carmine Vecchione, Enrico Patrucco, Gennaro Marino, Laura Barberis, Roberta Poulet, Alessandra Aretini, Angelo Maffei, Maria Teresa Gentile, Marianna Storto, Ornella Azzolino, Mara Brancaccio, Gian Luca Colussi, Umberto Bettarini, Fiorella Altruda, Lorenzo Silengo, Guido Tarone, Mathias P. Wymann, Emilio Hirsch, and Giuseppe Lembo,
J. Exp. Med. 2005 Apr 18;201(8):1217-28.
[AKT1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201850 | AKT1 (Myc-DDK-tagged)-Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3 |
CNY 3,656.00 |
|
| RC201850L1 | Lenti ORF clone of Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3, Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC201850L2 | Lenti ORF clone of Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3, mGFP tagged |
CNY 6,056.00 |
|
| RC201850L3 | Lenti ORF clone of Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3, Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC201850L4 | Lenti ORF clone of Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3, mGFP tagged |
CNY 6,056.00 |
|
| RG201850 | AKT1 (tGFP-tagged) - Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 3 |
CNY 5,256.00 |
