United States
Germany
Japan
United Kingdom
China
PITX1 (NM_002653) Human Untagged Clone
CAT＃: SC320324
PITX1 (untagged)-Human paired-like homeodomain 1 (PITX1)
CNY 3,600.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BFT; CCF; LBNBG; POTX; PTX1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_002653 edited
CTGGGGACTTCGAGGCGGCCGAGACGGGAGTTGATTCTAGGCGAAACAAGTCATTTGAGG CCTGAGGTCGCAGCCAGGGCGGCGGGGCGCGCCCAGCCCCGGCCCCTGGAGCGCCCGCCG CGGTCCCCACCTCCATGGACGCCTTCAAGGGGGGCATGAGCCTGGAGCGGCTGCCGGAGG GGCTCCGGCCGCCGCCGCCGCCACCCCATGACATGGGGCCCGCCTTCCACCTGGCCCGGC CCGCCGACCCCCGCGAGCCGCTCGAGAACTCCGCCAGCGAGTCGTCTGACACGGAGCTGC CAGAGAAGGAGCGCGGCGGGGAACCCAAGGGGCCCGAGGACAGTGGTGCGGGAGGCACGG GCTGCGGCGGCGCAGACGACCCAGCCAAGAAGAAGAAGCAGCGGCGGCAACGTACGCACT TCACAAGCCAGCAGTTGCAAGAGCTAGAGGCCACGTTCCAGAGGAACCGCTACCCCGACA TGAGCATGAGGGAGGAGATCGCCGTGTGGACCAACCTCACCGAGCCGCGCGTGCGGGTCT GGTTCAAGAACCGGCGAGCCAAGTGGCGTAAGCGCGAGCGTAACCAGCAGCTGGACCTGT GCAAGGGTGGCTACGTGCCGCAGTTCAGCGGCCTAGTGCAGCCCTACGAGGACGTGTACG CCGCCGGCTACTCCTACAACAACTGGGCCGCCAAGAGCCTGGCGCCAGCGCCGCTCTCCA CCAAGAGCTTCACCTTCTTCAACTCCATGAGCCCGCTGTCGTCGCAGTCCATGTTCTCAG CACCCAGCTCCATCTCCTCCATGACCATGCCGTCCAGCATGGGCCCAGGCGCCGTGCCTG GCATGCCCAACTCGGGCCTCAACAACATCAACAACCTCACCGGCTCCTCGCTCAACTCGG CCATGTCGCCGGGCGCTTGCCCGTACGGCACTCCCGCCTCGCCCTACAGCGTCTACCGGG ACACGTGCAACTCGAGCCTAGCCAGCCTGCGGCTCAAGTCCAAACAGCACTCGTCGTTTG GCTACGGCGCCCTGCAGGGCCCGGCCTCGGGCCTCAACGCGTGCCAGTACAACAGCTGAC CGCCCCGCCGCACCACGCGGGCCGGCGGCCGGAGCGGGGAAGGGCGCGGGCGCGGAGGAC GCACGCGGGGCCCCGGCTCGCAAGCCCCAGCTCACCGCGCCGCGGACCTCACACCTGCGC AGCCCCCTCCTCCCACTTCCCACTCCGGGTTGGTTTTGTGTTTGCTTTTCCGGACCCCAC TCTGCCCTCCAAAAAGACAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002653 |
| Insert Size | 1500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_002653.3 |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002653.3, NP_002644.3 |
| RefSeq Size | 2373 bp |
| RefSeq ORF | 945 bp |
| Locus ID | 5307 |
| UniProt ID | P78337 |
| Protein Families | Transcription Factors |
| Gene Summary | This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
BMP15 c.-9C>G promoter sequence variant may contribute to the cause of non-syndromic premature ovarian failure
,Fonseca, DJ;Ortega-Recalde, O;,
Reproductive BioMedicine Online
[PITX1]
|
|
Identification of PITX1 as a TERT Suppressor Gene Located on Human Chromosome 5
,Dong-Lai Qi, Takahito Ohhira, Chikako Fujisaki, Toshiaki Inoue, Tsutomu Ohta, Mitsuhiko Osaki, Eriko Ohshiro, Tomomi Seko, Shinsuke Aoki, Mitsuo Oshimura, and Hiroyuki Kugoh,
Mol. Cell. Biol., Apr 2011; 31: 1624 - 1636
[PITX1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202570 | PITX1 (Myc-DDK-tagged)-Human paired-like homeodomain 1 (PITX1) |
CNY 3,600.00 |
|
| RC202570L1 | Lenti-ORF clone of PITX1 (Myc-DDK-tagged)-Human paired-like homeodomain 1 (PITX1) |
CNY 5,890.00 |
|
| RC202570L2 | Lenti-ORF clone of PITX1 (mGFP-tagged)-Human paired-like homeodomain 1 (PITX1) |
CNY 5,890.00 |
|
| RC202570L3 | Lenti-ORF clone of PITX1 (Myc-DDK-tagged)-Human paired-like homeodomain 1 (PITX1) |
CNY 5,890.00 |
|
| RC202570L4 | Lenti-ORF clone of PITX1 (mGFP-tagged)-Human paired-like homeodomain 1 (PITX1) |
CNY 5,890.00 |
|
| RG202570 | PITX1 (tGFP-tagged) - Human paired-like homeodomain 1 (PITX1) |
CNY 5,200.00 |
|
| SC303233 | PITX1 (untagged)-Human paired-like homeodomain 1 (PITX1) |
CNY 6,270.00 |
