LYPD1 (NM_144586) Human Untagged Clone

CAT#: SC320440

LYPD1 (untagged)-Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 1



  "NM_144586" in other vectors (7)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LYPDC1; PHTS
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_144586.5 CCGGAGGCGCGGTGCTCGGCCCGGGAGCGCGAGCGGGAGGAGCAGAGACCCGCAGCCGGG
AGCCCGAGCGCGGGCGATGCAGGCTCCGCGAGCGGCACCTGCGGCTCCTCTAAGCTACGA
CCGTCGTCTCCGCGGCAGCAGCGCGGGCCCCAGCAGCCTCGGCAGCCACAGCCGCTGCAG
CCGGGGCAGCCTCCGCTGCTGTCGCCTCCTCTGATGCGCTTGCCCTCTCCCGGCCCCGGG
ACTCCGGGAGAATGTGGGTCCTAGGCATCGCGGCAACTTTTTGCGGATTGTTCTTGCTTC
CAGGCTTTGCGCTGCAAATCCAGTGCTACCAGTGTGAAGAATTCCAGCTGAACAACGACT
GCTCCTCCCCCGAGTTCATTGTGAATTGCACGGTGAACGTTCAAGACATGTGTCAGAAAG
AAGTGATGGAGCAAAGTGCCGGGATCATGTACCGCAAGTCCTGTGCATCATCAGCGGCCT
GTCTCATCGCCTCTGCCGGGTACCAGTCCTTCTGCTCCCCAGGGAAACTGAACTCAGTTT
GCATCAGCTGCTGCAACACCCCTCTTTGTAACGGGCCAAGGCCCAAGAAAAGGGGAAGTT
CTGCCTCGGCCCTCAGGCCAGGGCTCCGCACCACCATCCTGTTCCTCAAATTAGCCCTCT
TCTCGGCACACTGCTGAAGCTGAAGGAGATGCCACCCCCTCCTGCATTGTTCTTCCAGCC
CTCGCCCCCAACCCCCCACCTCCCTGAGTGAGTTTCTTCTGGGTGTCCTTTTATTCTGGG
TAGGGAGCGGGAGTCCGTGTTCTCTTTTGTTCCTGTGCAAATAATGAAAGAGCTCGGTAA
AGCATTCTGAATAAATTCAGCCTGACTGAATTTTCAGTATGTACTTGAAGGAAGGAGGTG
GAGTGAAAGTTCACCCCCAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_144586
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_144586.5, NP_653187.3
RefSeq Size 2683 bp
RefSeq ORF 426 bp
Locus ID 116372
UniProt ID Q8N2G4
Protein Families Druggable Genome, Transmembrane
Gene Summary Believed to act as a modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro increases receptor desensitization and decreases affinity for ACh of alpha-4:beta-2-containing nAChRs. May play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. May be involved in the control of anxiety.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and it encodes the longer protein (isoform a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...