United States
Germany
Japan
United Kingdom
China
RPS3A (NM_001006) Human Untagged Clone
CAT＃: SC320696
RPS3A (untagged)-Human ribosomal protein S3A (RPS3A)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FTE1; MFTL; S3A |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001006.3
CTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCGGCAAAAAGGGA
GCCAAGAAGAAAGTGGTTGATCCATTTTCTAAGAAAGATTGGTATGATGTGAAAGCACCT GCTATGTTCAATATAAGAAATATTGGAAAGACGCTCGTCACCAGGACCCAAGGAACCAAA ATTGCATCTGATGGTCTCAAGGGTCGTGTGTTTGAAGTGAGTCTTGCTGATTTGCAGAAT GATGAAGTTGCATTTAGAAAATTCAAGCTGATTACTGAAGATGTTCAGGGTAAAAACTGC CTGACTAACTTCCATGGCATGGATCTTACCCGTGACAAAATGTGTTCCATGGTCAAAAAA TGGCAGACAATGATTGAAGCTCACGTTGATGTCAAGACTACCGATGGTTACTTGCTTCGT CTGTTCTGTGTTGGTTTTACTAAAAAACGCAACAATCAGATACGGAAGACCTCTTATGCT CAGCACCAACAGGTCCGCCAAATCCGGAAGAAGATGATGGAAATCATGACCCGAGAGGTG CAGACAAATGACTTGAAAGAAGTGGTCAATAAATTGATTCCAGACAGCATTGGAAAAGAC ATAGAAAAGGCTTGCCAATCTATTTATCCTCTCCATGATGTCTTCGTTAGAAAAGTAAAA ATGCTGAAGAAGCCCAAGTTTGAATTGGGAAAGCTCATGGAGCTTCATGGTGAAGGCAGT AGTTCTGGAAAAGCCACTGGGGACGAGACAGGTGCTAAAGTTGAACGAGCTGATGGATAT GAACCACCAGTCCAAGAATCTGTTTAAAGTTCAGACTTCAAATAGTGGCAAATAAAAAGT GCTATTTGTGATGGTTTGCTTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001006 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001006.3, NP_000997.1 |
| RefSeq Size | 930 bp |
| RefSeq ORF | 795 bp |
| Locus ID | 6189 |
| UniProt ID | P61247 |
| Domains | Ribosomal_S3Ae |
| Protein Pathways | Ribosome |
| Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201213 | RPS3A (Myc-DDK-tagged)-Human ribosomal protein S3A (RPS3A) |
CNY 3,600.00 |
|
| RC201213L1 | Lenti ORF clone of Human ribosomal protein S3A (RPS3A), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC201213L2 | Lenti ORF clone of Human ribosomal protein S3A (RPS3A), mGFP tagged |
CNY 5,890.00 |
|
| RC201213L3 | Lenti ORF clone of Human ribosomal protein S3A (RPS3A), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201213L4 | Lenti ORF clone of Human ribosomal protein S3A (RPS3A), mGFP tagged |
CNY 5,890.00 |
|
| RG201213 | RPS3A (tGFP-tagged) - Human ribosomal protein S3A (RPS3A) |
CNY 5,200.00 |
|
| SC119513 | RPS3A (untagged)-Human ribosomal protein S3A (RPS3A) |
CNY 2,400.00 |
