PPAP2C (PLPP2) (NM_003712) Human Untagged Clone
CAT#: SC320713
PPAP2C (untagged)-Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LPP2; PAP-2c; PAP2-g; PPAP2C |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_003712.2
CCGGGACGCGACGGGACGCGCTGGGACCGGCGTCGGGGGTCGCGGGGACCATGCAGCGGA
GGTGGGTCTTCGTGCTGCTCGACGTGCTGTGCTTACTGGTCGCCTCCCTGCCCTTCGCTA TCCTGACGCTGGTGAACGCCCCGTACAAGCGAGGATTTTACTGCGGGGATGACTCCATCC GGTACCCCTACCGTCCAGATACCATCACCCACGGGCTCATGGCTGGGGTCACCATCACGG CCACCGTCATCCTTGTCTCGGCCGGGGAAGCCTACCTGGTGTACACAGACCGGCTCTATT CTCGCTCGGACTTCAACAACTACGTGGCTGCTGTATACAAGGTGCTGGGGACCTTCCTGT TTGGGGCTGCCGTGAGCCAGTCTCTGACAGACCTGGCCAAGTACATGATTGGGCGTCTGA GGCCCAACTTCCTAGCCGTCTGCGACCCCGACTGGAGCCGGGTCAACTGCTCGGTCTATG TGCAGCTGGAGAAGGTGTGCAGGGGAAACCCTGCTGATGTCACCGAGGCCAGGTTGTCTT TCTACTCGGGACACTCTTCCTTTGGGATGTACTGCATGGTGTTCTTGGCGCTGTATGTGC AGGCACGACTCTGTTGGAAGTGGGCACGGCTGCTGCGACCCACAGTCCAGTTCTTCCTGG TGGCCTTTGCCCTCTACGTGGGCTACACCCGCGTGTCTGATTACAAACACCACTGGAGCG ATGTCCTTGTTGGCCTCCTGCAGGGGGCACTGGTGGCTGCCCTCACTGTCTGCTACATCT CAGACTTCTTCAAAGCCCGACCCCCACAGCACTGTCTGAAGGAGGAGGAGCTGGAACGGA AGCCCAGCCTGTCACTGACGTTGACCCTGGGCGAGGCTGACCACAACCACTATGGATACC CGCACTCCTCCTCCTGAGGCCGGACCCCGCCCAGGCAGGGAGCTACTGTGAGTCCAGCTG AGGCCCACCCAGGTGGTCCCTCCAGCCCTGGTTAGGCACTGAGGGCTCTGGACGGGCTCC AGGAACCCTGGGCTGATGGGAGCAGTGAGCGGGCTCCGCTGCCCCCTGCCCTGCACTGGA CCAGGAGTCTGGAGATGCCTGGGTAGCCCTCAGCATTTGGAGGGGAACCTGTTCCCGTCG GTCCCCAAATATCCCCTTCTTTTTATGGGGTTAAGGAAGGGACCGAGAGATCAGATAGTT GCTGTTTTGTAAAATGTAATGTATATGTGGTTTTTAGTAAAATAGGGCACCTGTTTCAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003712 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003712.2, NP_003703.1 |
RefSeq Size | 1327 bp |
RefSeq ORF | 867 bp |
Locus ID | 8612 |
UniProt ID | O43688 |
Domains | acidPPc |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transmembrane |
Protein Pathways | Ether lipid metabolism, Fc gamma R-mediated phagocytosis, Glycerolipid metabolism, Glycerophospholipid metabolism, Metabolic pathways, Sphingolipid metabolism |
Gene Summary | The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) differs in the 5' region, including the 5' UTR and 5' coding region, as compared to variant 3. The resulting isoform (1) has a distinct and shorter N-terminus, as compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201192 | PPAP2C (Myc-DDK-tagged)-Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 1 |
CNY 2,400.00 |
|
RC201192L3 | Lenti ORF clone of Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201192L4 | Lenti ORF clone of Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG201192 | PPAP2C (tGFP-tagged) - Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 1 |
CNY 4,370.00 |
|
SC109963 | PPAP2C (untagged)-Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 1 |
CNY 2,400.00 |