United States
Germany
Japan
United Kingdom
China
DLK (DLK1) (NM_003836) Human Untagged Clone
CAT＃: SC320741
DLK1 (untagged)-Human delta-like 1 homolog (Drosophila) (DLK1)
CNY 5,488.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Delta1; DLK; DLK-1; FA1; pG2; Pref-1; PREF1; ZOG |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003836.4
GAGAGCGCAGCGCGCAGCCCGGTGCAGCCCTGGCTTTCCCCTCGCTGCGCGCCCGCGCCC
CCTTTCGCGTCCGCAACCAGAAGCCCAGTGCGGCGCCAGGAGCCGGACCCGCGCCCGCAC CGCTCCCGGGACCGCGACCCCGGCCGCCCAGAGATGACCGCGACCGAAGCCCTCCTGCGC GTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGGCTGAATGCTTCCCGGCC TGCAACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCCTGGCTGG CAGGGTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGA GAACCCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTT CGGGCCTGCTCCTCGGCCCCCTGTGCCAACAACGGGACCTGCGTGAGCCTGGACGATGGC CTCTATGAATGCTCCTGTGCCCCCGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGG CCCTGTGTGATCAACGGCTCCCCCTGCCAGCACGGAGGCACCTGCGTGGATGATGAGGGC CGGGCCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAGGCAATTTCTGCGAGATC GTGGCCAACAGCTGCACCCCCAACCCATGCGAGAACGACGGCGTCTGCACTGACATCGGG GGCGACTTCCGCTGCCGGTGCCCAGCCGGCTTCATCGACAAGACCTGCAGCCGCCCGGTG ACCAACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGCCTGCAGCACACCCAGGTG AGCTACGAGTGTCTGTGCAAGCCCGAGTTCACAGGTCTCACCTGTGTCAAGAAGCGCGCG CTGAGCCCCCAGCAGGTCACCCGTCTGCCCAACGGCTATGGGCTGGCCTACCGCCTGACC CCTGGGGTGCACGAGCTGCCGGTGCAGCAGCCGGAGCACCGCATCCTGAAGGTGTCCATG AAAGAGCTCAACAAGAAAACCCCTCTCCTCACCGAGGGCCAGGCCATCTGCTTCACCATC CTGGGCGTGCTCACCAGCCTGGTGGTGCTGGGCACTGTGGGTATCGTCTTCCTCAACAAG TGCGAGACCTGGGTGTCCAACCTGCGCTACAACCACATGCTGCGGAAGAAGAAGAACCTG CTGCTTCAGTACAACAGCGGGGAGGACCTGGCCGTCAACATCATCTTCCCCGAGAAGATC GACATGACCACCTTCAGCAAGGAGGCCGGCGACGAGGAGATCTAAGCAGCGTTCCCACAG CCCCCTCTAGATTCTTGGAGTTCCTCAGAGCTTACTATACGCGGTCTGTCCTAATCTTTG TGGTGTTCGCTATCTCTTGTGTCAAATCTGGTGAACGCTACGCTTACATATATTGTCTTT GTGCTGCTGTGTGACAAACGCAATGCAAAAACAATCCTCTTTCTCTCTCTTAATGCATGA TACAGAATAATAATAAGAATTTCATCTTTAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_003836 |
| Insert Size | 1500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003836.4, NP_003827.3 |
| RefSeq Size | 1532 bp |
| RefSeq ORF | 1152 bp |
| Locus ID | 8788 |
| UniProt ID | P80370 |
| Domains | EGF_CA, EGF, EGF |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane |
| Gene Summary | This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
DLK1(PREF1) is a negative regulator of adipogenesis in CD105⁺/CD90⁺/CD34⁺/CD31⁻/FABP4⁻ adipose-derived stromal cells from subcutaneous abdominal fat pats of adult women.
,null,
Stem cell research
,PubMed ID 22640926
[DLK1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202923 | DLK1 (Myc-DDK-tagged)-Human delta-like 1 homolog (Drosophila) (DLK1) |
CNY 5,488.00 |
|
| RC202923L1 | Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC202923L2 | Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), mGFP tagged |
CNY 5,890.00 |
|
| RC202923L3 | Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC202923L4 | Lenti ORF clone of Human delta-like 1 homolog (Drosophila) (DLK1), mGFP tagged |
CNY 7,888.00 |
|
| RG202923 | DLK1 (tGFP-tagged) - Human delta-like 1 homolog (Drosophila) (DLK1) |
CNY 7,088.00 |
|
| SC127962 | DLK1 (untagged)-Human delta-like 1 homolog (Drosophila) (DLK1) |
CNY 5,488.00 |
