United States
Germany
Japan
United Kingdom
China
CAVIN3 (NM_145040) Human Untagged Clone
CAT＃: SC320781
PRKCDBP (untagged)-Human protein kinase C, delta binding protein (PRKCDBP)
CNY 2,400.00
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | cavin-3; HSRBC; PRKCDBP; SRBC |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_145040.2
GTTGCAGGCAGACGGAGCAGAGCGGTCAGGGATCATGAGGGAGAGTGCGTTGGAGCCGGG
GCCTGTGCCCGAGGCGCCGGCGGGGGGTCCCGTGCACGCCGTGACGGTGGTGACCCTGCT GGAGAAGCTGGCCTCCATGCTGGAGACTCTGCGGGAGCGGCAGGGAGGCCTGGCTCGAAG GCAGGGAGGCCTGGCAGGGTCCGTGCGCCGCATCCAGAGCGGCCTGGGCGCTCTGAGTCG CAGCCACGACACCACCAGCAACACCTTGGCGCAGCTGCTGGCCAAGGCGGAGCGCGTGAG CTCGCACGCCAACGCCGCCCAAGAGCGCGCGGTGCGCCGCGCAGCCCAGGTGCAGCGGCT GGAGGCCAACCACGGGCTGCTGGTGGCGCGCGGGAAGCTCCACGTTCTGCTCTTCAAGGA GGAGGGTGAAGTCCCAGCCAGCGCTTTCCAGAAGGCACCAGAGCCCTTGGGCCCGGCGGA CCAGTCCGAGCTGGGCCCAGAGCAGCTGGAGGCCGAAGTTGGAGAGAGCTCGGACGAGGA GCCGGTGGAGTCCAGGGCCCAGCGGCTGCGGCGCACCGGATTGCAGAAGGTACAGAGCCT CCGAAGGGCCCTTTCGGGCCGGAAAGGCCCTGCAGCGCCACCGCCCACCCCGGTCAAGCC GCCTCGCCTTGGGCCTGGCCGGAGCGCTGAAGCCCAGCCGGAAGCCCAGCCTGCGCTGGA GCCCACGCTGGAGCCAGAGCCTCCGCAGGACACCGAGGAAGATCCCGGGAGACCTGGGGC TGCCGAAGAAGCTCTGCTCCAAATGGAGAGTGTAGCCTGAGGGCTGGTGTTGCCTGCCTC CCCTGTGCTTGTGCCTTGTCCCAAAATAAATCCTTTCAGAATGTAGCACTCACGCCCTAA TAAGGAGCGAATCCTACATCCACCAAGGCGGGCGCTCTGGCCCTCCCTTCCTTAAGCCCA GTCCTGTGTCCTCTGAAAGAGGTGCAGTCACTCACACCTGCTTGCGCTCACCATCAATAA AAGTAATTTCACCCGAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_145040 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145040.2, NP_659477.2 |
| RefSeq Size | 1039 bp |
| RefSeq ORF | 786 bp |
| Locus ID | 112464 |
| UniProt ID | Q969G5 |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene was identified as a binding protein of the protein kinase C, delta (PRKCD). The expression of this gene in cultured cell lines is strongly induced by serum starvation. The expression of this protein was found to be down-regulated in various cancer cell lines, suggesting the possible tumor suppressor function of this protein. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Epigenetic Inactivation of the BRCA1 Interactor SRBC and Resistance to Oxaliplatin in Colorectal Cancer
,null,
JNCI Journal of the National Cancer Institute
,PubMed ID 24273214
[CAVIN3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204254 | PRKCDBP (Myc-DDK-tagged)-Human protein kinase C, delta binding protein (PRKCDBP) |
CNY 2,400.00 |
|
| RC204254L1 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC204254L2 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), mGFP tagged |
CNY 5,890.00 |
|
| RC204254L3 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204254L4 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), mGFP tagged |
CNY 5,890.00 |
|
| RG204254 | PRKCDBP (tGFP-tagged) - Human protein kinase C, delta binding protein (PRKCDBP) |
CNY 4,000.00 |
|
| SC311245 | PRKCDBP (untagged)-Human protein kinase C, delta binding protein (PRKCDBP) |
CNY 3,990.00 |
