DCUN1D1 (NM_020640) Human Untagged Clone
CAT#: SC320881
DCUN1D1 (untagged)-Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DCNL1; DCUN1L1; RP42; SCCRO; SCRO; Tes3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_020640.2
GGAGGAGGAGGGGAGAGGCCTGGAGGACACCAACATGAACAAGTTGAAATCATCGCAGAA
GGATAAAGTTCGTCAGTTTATGATCTTCACACAATCTAGTGAAAAAACAGCAGTAAGTTG TCTTTCTCAAAATGACTGGAAGTTAGATGTTGCAACAGATAATTTTTTCCAAAATCCTGA ACTTTATATACGAGAGAGTGTAAAAGGATCATTGGACAGGAAGAAGTTAGAACAGCTGTA CAATAGATACAAAGACCCTCAAGATGAGAATAAAATTGGAATAGATGGCATACAGCAGTT CTGTGATGACCTGGCACTCGATCCAGCCAGCATTAGTGTGTTGATTATTGCATGGAAGTT CAGAGCAGCAACACAGTGCGAGTTCTCCAAACAGGAGTTCATGGATGGCATGACAGAATT AGGATGTGACAGCATAGAAAAACTAAAGGCCCAGATACCCAAGATGGAACAAGAATTGAA AGAACCAGGACGATTTAAGGATTTTTACCAGTTTACTTTTAATTTTGCAAAGAATCCAGG ACAAAAAGGATTAGATCTAGAAATGGCCATTGCCTACTGGAACTTAGTGCTTAATGGAAG ATTTAAATTCTTAGACTTATGGAATAAATTTTTGTTGGAACATCATAAACGATCAATACC AAAAGACACTTGGAATCTTCTTTTAGACTTCAGTACGATGATTGCAGATGACATGTCTAA TTATGATGAAGAAGGAGCATGGCCTGTTCTTATTGATGACTTTGTGGAATTTGCACGCCC TCAAATTGCTGGGACAAAAAGTACAACAGTGTAGCACTAAAGGAACCTTCTAGAATGTAC ATAGTCTGTACAATAAATACAACAGAAAATTGCACAGTCAATTTCTGCTGGCTGGACTGA ACTGAAGATCAATCCTCACAATTCAGACTGAGGGTTGAGACAAAACTTTAAGGATACATC TTGGACCATATCGTATTTCATTCTTCTAATGGTGGTTTGGGCTTGTCTTCTAGTCTGGGC CGCTCTAAACATTTATAATTCCAACATTGTGGATTTCATCTTATATCTGTGGACCATCCT AGTTTATTCTCCCATAAGTCTTAGAAGCTTTATGGTGATTATTTTGAGGTTTTCATTCTC GCATAAAGCACAATGCTGTCTTCATCAGAAAACAGTTGGCATAAGAATTAAACATATGAA CATCACAAAACAATTTATAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_020640 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_020640.2, NP_065691.2 |
RefSeq Size | 3192 bp |
RefSeq ORF | 780 bp |
Locus ID | 54165 |
UniProt ID | Q96GG9 |
Domains | DUF298 |
Protein Families | Druggable Genome |
Gene Summary | Part of an E3 ubiquitin ligase complex for neddylation. Promotes neddylation of cullin components of E3 cullin-RING ubiquitin ligase complexes. Acts by binding to cullin-RBX1 complexes in the cytoplasm and promoting their nuclear translocation, enhancing recruitment of E2-NEDD8 (UBE2M-NEDD8) thioester to the complex, and optimizing the orientation of proteins in the complex to allow efficient transfer of NEDD8 from the E2 to the cullin substrates. Involved in the release of inhibitory effets of CAND1 on cullin-RING ligase E3 complex assembly and activity (PubMed:25349211, PubMed:28581483). Acts also as an oncogene facilitating malignant transformation and carcinogenic progression (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203427 | DCUN1D1 (Myc-DDK-tagged)-Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1) |
CNY 2,400.00 |
|
RC203427L1 | Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC203427L2 | Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1), mGFP tagged |
CNY 5,890.00 |
|
RC203427L3 | Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203427L4 | Lenti ORF clone of Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1), mGFP tagged |
CNY 5,890.00 |
|
RG203427 | DCUN1D1 (tGFP-tagged) - Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1) |
CNY 4,000.00 |
|
SC113101 | DCUN1D1 (untagged)-Human DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (DCUN1D1) |
CNY 2,400.00 |
其它DCUN1D1产品