Corticotropin Releasing Factor (CRH) (NM_000756) Human Untagged Clone

CAT#: SC320891

CRH (untagged)-Human corticotropin releasing hormone (CRH)



  "NM_000756" in other vectors (7)

CNY 2,400.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CRH Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRF; CRH1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_000756.1 GGGAGAAACTCAGAGACCAAGTCCATTGAGAGACTGAGGGGAAAGAGAGGAGAGAAAGAA
AAAGAGAGTGGGAACAGTAAAGAGAAAGGAAGACTACCTCCAGAGAAAGCCCCCGGAGAC
GTCTCTCTGCAGAGAGGCGGCAGCACCCGGCTCACCTGCGAAGCGCCTGGGAAGCGAGTG
CCCCTAACATGCGGCTGCCGCTGCTTGTGTCCGCGGGAGTCCTGCTGGTGGCTCTCCTGC
CCTGCCCGCCATGCAGGGCGCTCCTGAGCCGCGGGCCGGTCCCGGGAGCTCGGCAGGCGC
CGCAGCACCCTCAGCCCTTGGATTTCTTCCAGCCGCCGCCGCAGTCCGAGCAGCCCCAGC
AGCCGCAGGCTCGGCCGGTCCTGCTCCGCATGGGAGAGGAGTACTTCCTCCGCCTGGGGA
ACCTCAACAAGAGCCCGGCCGCTCCCCTTTCGCCCGCCTCCTCGCTCCTCGCCGGCGGCA
GCGGCAGCCGCCCTTCGCCGGAACAGGCGACCGCCAACTTTTTCCGCGTGTTGCTGCAGC
AGCTGCTGCTGCCTCGGCGCTCGCTCGACAGCCCCGCGGCTCTCGCGGAGCGCGGCGCTA
GGAATGCCCTCGGCGGCCACCAGGAGGCACCGGAGAGAGAAAGGCGGTCCGAGGAGCCTC
CCATCTCCCTGGATCTCACCTTCCACCTCCTCCGGGAAGTCTTGGAAATGGCCAGGGCCG
AGCAGTTAGCACAGCAAGCTCACAGCAACAGGAAACTCATGGAGATTATTGGGAAATAAA
ACGGTGCGTTTGGCCAAAAAGAATCTGCATTTAGCACAAAAAAAAATTTAAAAAAATACA
GTATTCTGTACCATAGCGCTGCTCTTATGCCATTTGTTTATTTTTATATAGCTTGAAACA
TAGAGGGAGAGAGGGAGAGAGCCTATACCCCTTACTTAGCATGCACAAAGTGTATTCACG
TGCAGCAGCAACACAATGTTATTCGTTTTGTCTACGTTTAGTTTCCGTTTCCAGGTGTTT
ATAGTGGTGTTTTAAAGAGAATGTAGACCTGTGAGAAAACGTTTTGTTTGAAAAAGCAGA
CAGAAGTCACTCAATTGTTTTTGTTGTGGTCTGAGCCAAAGAGAATGCCATTCTCTTGGG
TGGGTAAGACTAAATCTGTAAGCTCTTTGAAACAACTTTCTCTTGTAAACGTTTCAGTAA
TAAAACATCTTTCCAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_000756
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000756.1, NP_000747.1
RefSeq Size 1279 bp
RefSeq ORF 591 bp
Locus ID 1392
UniProt ID P06850
Domains CRF
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Long-term depression
Gene Summary This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Corticotropin Releasing Factor产品

Customer Reviews 
Loading...