NPM3 (NM_006993) Human Untagged Clone
CAT#: SC320983
NPM3 (untagged)-Human nucleophosmin/nucleoplasmin 3 (NPM3)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PORMIN; TMEM123 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006993.1
GGGGACAGCATGGCCGCCGGTACTGCAGCTGCCTTAGCGTTTTTGAGTCAGGAGAGCCGA
ACGCGGGCCGGGGGTGTCGGGGGCCTACGGGTCCCGGCCCCGGTCACTATGGACAGTTTT TTCTTCGGCTGTGAGCTCTCCGGCCACACCCGCTCCTTCACCTTTAAGGTAGAGGAAGAG GATGATGCGGAGCACGTGCTGGCACTAACCATGCTCTGCCTCACCGAGGGAGCCAAAGAC GAGTGTAATGTGGTAGAAGTTGTGGCCCGGAACCATGACCATCAGGAGATCGCAGTCCCT GTGGCCAACCTCAAGCTGTCCTGCCAACCCATGCTCAGTCTGGATGACTTCCAGCTCCAA CCACCTGTAACCTTCCGCCTGAAGTCGGGCTCTGGCCCTGTGCGGATCACTGGGCGGCAC CAGATTGTTACGATGAGCAATGATGTTTCTGAGGAGGAGAGCGAGGAAGAGGAAGAGGAC AGTGATGAGGAAGAAGTTGAGCTGTGCCCCATCCTTCCTGCCAAAAAGCAGGGGGGCAGG CCCTAGCCCTCCTAGGTCAGCTCCATGTGCCATGCACCGCCATGCACCCTGTTCCCTGAC AAGTTTCAACAATTGTAAATATTTCTTCCTTGAAGAGGAGAGCTTGGGTGGGGGTTGGGT GGGAGGGACTTGGGTCTTTGGTGCTAGGAGAGGGCCTGTGCTCCACACAGCCGTGGTTTT CTGATTTTCACCATGCCCGGGGCCTCCCTTCCCACCTGCCTGTGAGAATTGGAGGTTAGT GCCTGAAGCTCAGAGCTACACATTTTTAATAGTTTTTACATTTTTGGATAAAGGTTGAAA TAAAGTGGTGTGGAGTTTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006993 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006993.1, NP_008924.1 |
RefSeq Size | 884 bp |
RefSeq ORF | 537 bp |
Locus ID | 10360 |
UniProt ID | O75607 |
Gene Summary | The protein encoded by this gene is related to the nuclear chaperone phosphoproteins, nucleoplasmin and nucleophosmin. This protein is strongly expressed in diverse cell types where it localizes primarily to the nucleus. Based on its similarity to nucleoplasmin and nucleophosmin, this protein likely functions as a molecular chaperone in the cell nucleus. [provided by RefSeq, Oct 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208869 | NPM3 (Myc-DDK-tagged)-Human nucleophosmin/nucleoplasmin 3 (NPM3) |
CNY 2,400.00 |
|
RC208869L1 | Lenti ORF clone of Human nucleophosmin/nucleoplasmin 3 (NPM3), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC208869L2 | Lenti ORF clone of Human nucleophosmin/nucleoplasmin 3 (NPM3), mGFP tagged |
CNY 5,890.00 |
|
RC208869L3 | Lenti ORF clone of Human nucleophosmin/nucleoplasmin 3 (NPM3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208869L4 | Lenti ORF clone of Human nucleophosmin/nucleoplasmin 3 (NPM3), mGFP tagged |
CNY 5,890.00 |
|
RG208869 | NPM3 (tGFP-tagged) - Human nucleophosmin/nucleoplasmin 3 (NPM3) |
CNY 4,370.00 |
|
SC115768 | NPM3 (untagged)-Human nucleophosmin/nucleoplasmin 3 (NPM3) |
CNY 2,400.00 |