Caspase 4 (CASP4) (NM_033306) Human Untagged Clone
CAT#: SC321104
CASP4 (untagged)-Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma
CNY 2,400.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ICE(rel)II; ICEREL-II; ICH-2; Mih1; Mih1/TX; TX |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_033306.2
CTTTTCCAACGCTGTAAAAAAGGACAGAGGCTGTTCCCTATGGCAGAAGGCAACCACAGA
AAAAAGCCACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCACTGGTGTTTTGGAT AACTTGGTGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAAAGAAATATTACGAT GCTAAAACTGAAGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATG GCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAA GCTCATCCGAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAG CTTTGTCCTCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCA ATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGAC CATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAG GGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCG CTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCACATTCTTGGTACTC ATGTCTCATGGCATCCTGGAGGGAATCTGCGGAACTGTGCATGATGAGAAAAAACCAGAT GTGCTGCTTTATGACACCATCTTCCAGATATTCAACAACCGCAACTGCCTCAGTCTGAAG GACAAACCCAAGGTCATCATTGTCCAGGCCTGCAGAGGTGCAAACCGTGGGGAACTGTGG GTCAGAGACTCTCCAGCATCCTTGGAAGTGGCCTCTTCACAGTCATCTGAGAACCTGGAG GAAGATGCTGTTTACAAGACCCACGTGGAGAAGGACTTCATTGCTTTCTGCTCTTCAACG CCACACAACGTGTCCTGGAGAGACAGCACAATGGGCTCTATCTTCATCACACAACTCATC ACATGCTTCCAGAAATATTCTTGGTGCTGCCACCTAGAGGAAGTATTTCGGAAGGTACAG CAATCATTTGAAACTCCAAGGGCCAAAGCTCAAATGCCCACCATAGAACGACTGTCCATG ACAAGATATTTCTACCTCTTTCCTGGCAATTGAAAATGGAAGCCACAAGCAGCCCAGCCC TCCTTAATCAACTTCAAGGAGCACCTTCATTAGTACAGCTTGCATATTTAACATTTTGTA TTTCAATAAAAGTGAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_033306 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033306.2, NP_150649.1 |
RefSeq Size | 1352 bp |
RefSeq ORF | 966 bp |
Locus ID | 837 |
UniProt ID | P49662 |
Domains | CASc, ICE_p10, ICE_p20 |
Protein Families | Druggable Genome, Protease |
Gene Summary | This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (gamma) includes an alternate exon in the 5' UTR and 5' coding region and uses a downstream in-frame start codon, compared to variant alpha. It encodes isoform gamma, which is shorter than isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204711 | CASP4 (Myc-DDK-tagged)-Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma |
CNY 5,488.00 |
|
RC204711L1 | Lenti ORF clone of Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC204711L2 | Lenti ORF clone of Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma, mGFP tagged |
CNY 5,890.00 |
|
RC204711L3 | Lenti ORF clone of Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204711L4 | Lenti ORF clone of Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma, mGFP tagged |
CNY 7,888.00 |
|
RG204711 | CASP4 (tGFP-tagged) - Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma |
CNY 4,370.00 |
|
SC124197 | CASP4 (untagged)-Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant gamma |
CNY 6,270.00 |
其它Caspase 4产品