Asporin (ASPN) (NM_017680) Human Untagged Clone
CAT#: SC321136
ASPN (untagged)-Human asporin (ASPN), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OS3; PLAP-1; PLAP1; SLRR1C |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_017680 edited
ATGAAGGAGTATGTGCTCCTATTATTCCTGGCTTTGTGCTCTGCCAAACCCTTCTTTAGC CCTTCACACATCGCACTGAAGAATATGATGCTGAAGGATATGGAAGACACAGATGATGAT GATGATGATGATGATGATGATGATGATGATGATGATGATGATGAGGAGGACAACTCTCTT TTTCCAACAAGAGAGCCAAGAAGCCATTTTTTTCCATTTGATCTGTTTCCAATGTGTCCA TTTGGATGTCAGTGCTATTCACGAGTTGTACATTGCTCAGATTTAGGTTTGACCTCAGTC CCAACCAACATTCCATTTGATACTCGAATGCTTGATCTTCAAAACAATAAAATTAAGGAA ATCAAAGAAAATGATTTTAAAGGACTCACTTCACTTTATGGTCTGATCCTGAACAACAAC AAGCTAACGAAGATTCACCCAAAAGCCTTTCTAACCACAAAGAAGTTGCGAAGGCTGTAT CTGTCCCACAATCAACTAAGTGAAATACCACTTAATCTTCCCAAATCATTAGCAGAACTC AGAATTCATGAAAATAAAGTTAAGAAAATACAAAAGGACACATTCAAAGGAATGAATGCT TTACACGTTTTGGAAATGAGTGCAAACCCTCTTGATAATAATGGGATAGAGCCAGGGGCA TTTGAAGGGGTGACGGTGTTCCATATCAGAATTGCAGAAGCAAAACTGACCTCAGTTCCT AAAGGCTTACCACCAACTTTATTGGAGCTTCACTTAGATTATAATAAAATTTCAACAGTG GAACTTGAGGATTTTAAACGATACAAAGAACTACAAAGGCTGGGCCTAGGAAACAACAAA ATCACAGATATCGAAAATGGGAGTCTTGCTAACATACCACGTGTGAGAGAAATACATTTG GAAAACAATAAACTAAAAAAAATCCCTTCAGGATTACCAGAGTTGAAATACCTCCAGATA ATCTTCCTTCATTCTAATTCAATTGCAAGAGTGGGAGTAAATGACTTCTGTCCAACAGTG CCAAAGATGAAGAAATCTTTATACAGTGCAATAAGTTTATTCAACAACCCGGTGAAATAC TGGGAAATGCAACCTGCAACATTTCGTTGTGTTTTGAGCAGAATGAGTGTTCAGCTTGGG AACTTTGGAATGTAA |
Restriction Sites | EcoRI-XhoI |
ACCN | NM_017680 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_017680.3, NP_060150.3 |
RefSeq Size | 2480 bp |
RefSeq ORF | 1143 bp |
Locus ID | 54829 |
UniProt ID | Q9BXN1 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a cartilage extracellular protein that is member of the small leucine-rich proteoglycan family. The encoded protein may regulate chondrogenesis by inhibiting transforming growth factor-beta 1-induced gene expression in cartilage. This protein also binds collagen and calcium and may induce collagen mineralization. Polymorphisms in the aspartic acid repeat region of this gene are associated with a susceptibility to osteoarthritis, and also with intervertebral disc disease. Alternative splicing of this gene results in multiple transcript variants.[provided by RefSeq, Jul 2014] Transcript Variant: This variant (1), which represents the D13 allele, is the longer transcript and encodes the longer isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Asporin Restricts Mesenchymal Stromal Cell Differentiation, Alters the Tumor Microenvironment, and Drives Metastatic Progression
,null,
Cancer research
,PubMed ID 31123087
[ASPN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209353 | ASPN (Myc-DDK-tagged)-Human asporin (ASPN), transcript variant 1 |
CNY 3,656.00 |
|
RC209353L1 | Lenti ORF clone of Human asporin (ASPN), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC209353L2 | Lenti ORF clone of Human asporin (ASPN), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC209353L3 | Lenti ORF clone of Human asporin (ASPN), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209353L4 | Lenti ORF clone of Human asporin (ASPN), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
RG209353 | ASPN (tGFP-tagged) - Human asporin (ASPN), transcript variant 1 |
CNY 5,256.00 |
|
SC304509 | ASPN (untagged)-Human asporin (ASPN), transcript variant 1 |
CNY 3,656.00 |
其它Asporin产品