SEC61G (NM_014302) Human Untagged Clone
CAT#: SC321165
SEC61G (untagged)-Human Sec61 gamma subunit (SEC61G), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SSS1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014302.3
GGCACGAGGCTGGCATTTTAGGTGTCGGTTGGGTAGGCAGTCATGGATCAGGTAATGCAG
TTTGTTGAGCCAAGTCGGCAGTTTGTAAAGGACTCCATTCGGCTGGTTAAAAGATGCACT AAACCTGATAGAAAAGAATTCCAGAAGATTGCCATGGCAACAGCAATAGGATTTGCTATA ATGGGATTCATTGGCTTCTTTGTGAAATTGATCCATATTCCTATTAATAACATCATTGTT GGTGGCTGAATACATTTTGGAAGAGAGTTTTTCATCTTAGAGATTGGTGAACAAGTGTGA GGGTGTGAGAAACTCACAGAATACAAATTTGCCTGTATGTTTTGTGGGTTTTTTTTTTCC TTTCAAGATGTTTTCTATTTCTAAATTAAAGTAATTTCAAAGTAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_014302 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014302.3, NP_055117.1 |
RefSeq Size | 484 bp |
RefSeq ORF | 207 bp |
Locus ID | 23480 |
UniProt ID | P60059 |
Domains | SecE |
Protein Families | Transmembrane |
Protein Pathways | Vibrio cholerae infection |
Gene Summary | The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the gamma-subunit protein. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203481 | SEC61G (Myc-DDK-tagged)-Human Sec61 gamma subunit (SEC61G), transcript variant 1 |
CNY 1,200.00 |
|
RC203481L1 | Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC203481L2 | Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC203481L3 | Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203481L4 | Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG203481 | SEC61G (tGFP-tagged) - Human Sec61 gamma subunit (SEC61G), transcript variant 1 |
CNY 2,800.00 |