United States
Germany
Japan
United Kingdom
China
AKR1C3 (NM_003739) Human Untagged Clone
CAT＃: SC321532
AKR1C3 (untagged)-Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3)
CNY 2,400.00
CNY 6,270.00
| Cited in 1 publication. |
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DD3; DDX; HA1753; HAKRB; HAKRe; hluPGFS; HSD17B5; PGFS |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003739.4
GTAATCTCTGAGGAGAAGCAGCAGCAAACATTTGCTAGTCAGACAAGTGACAGGGAATGG
ATTCCAAACACCAGTGTGTAAAGCTAAATGATGGCCACTTCATGCCTGTATTGGGATTTG GCACCTATGCACCTCCAGAGGTTCCAAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAA TAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTG GACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACA CTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAACT CACTGAAAAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATGTCTC TAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGACATAG TGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGT CCATTGGGGTGTCAAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCAGGAC TTAAGTACAAGCCTGTCTGCAACCAGGTAGAATGTCATCCGTATTTCAACCGGAGTAAAT TGCTAGATTTCTGCAAGTCGAAAGATATTGTTCTGGTTGCCTATAGTGCTCTGGGATCTC AACGAGACAAACGATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTCCTTT GTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAGCTGC AGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAACGTGC AGGTTTTTGAGTTCCAGTTGACTGCAGAGGACATGAAAGCCATAGATGGCCTAGACAGAA ATCTCCACTATTTTAACAGTGATAGTTTTGCTAGCCACCCTAATTATCCATATTCAGATG AATATTAACATGGAGAGCTTTGCCTGATGTCTACCAGAAGCCCTGTGTGTGGATGGTGAC GCAGAGGACGTCTCTATGCCGGTGACTGGACATATCACCTCTACTTAAATCCGTCCTGTT TAGCGACTTCAGTCAACTACAGCTGAGTCCATAGCCCAGAAAGACAATAAATTTTTATCA TTTTGAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_003739 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003739.4, NP_003730.4 |
| RefSeq Size | 1224 bp |
| RefSeq ORF | 972 bp |
| Locus ID | 8644 |
| UniProt ID | P42330 |
| Protein Families | Druggable Genome |
| Protein Pathways | Arachidonic acid metabolism, Metabolism of xenobiotics by cytochrome P450 |
| Gene Summary | This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes one of the larger isoforms (1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Elevated Expression of AKR1C3 Increases Resistance of Cancer Cells to Ionizing Radiation via Modulation of Oxidative Stress
,Xiong, W;Zhao, J;Yu, H;Li, X;Sun, S;Li, Y;Xia, Q;Zhang, C;He, Q;Gao, X;Zhang, L;Zhou, D;,
PLoS ONE
,PubMed ID 25419901
[AKR1C3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200210 | AKR1C3 (Myc-DDK-tagged)-Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3) |
CNY 2,400.00 |
|
| RC200210L1 | Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200210L2 | Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), mGFP tagged |
CNY 4,800.00 |
|
| RC200210L3 | Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200210L4 | Lenti ORF clone of Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3), mGFP tagged |
CNY 4,800.00 |
|
| RG200210 | AKR1C3 (tGFP-tagged) - Human aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) (AKR1C3) |
CNY 4,000.00 |
