NNMT (NM_006169) Human Untagged Clone
CAT#: SC321591
NNMT (untagged)-Human nicotinamide N-methyltransferase (NNMT)
CNY 2,400.00
CNY 2,950.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006169.2
TAGGCGCTGTGCTGGGGTCGCGGCGGCGCGGGCGCTGGGGGAGAGGAGTGTGGTCTTCAG
CATAGAGTGAGCTTCTAGTGACACGAGCTGGAGGGAAAGAGGAAGTGCATCATGACGGCT CGTCCAATGGACAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGG AAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCT CCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTA AGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCT GCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGAC GGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTC TCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAG GAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCTTTGACTGGTCCCCAGTGGTGACC TATGTGTGTGATCTTGAAGGGAACAGAGTCAAGGGTCCAGAGAAGGAGGAGAAGTTGAGA CAGGCGGTCAAGCAGGTGCTGAAGTGTGATGTGACTCAGAGCCAGCCACTGGGGGCCGTC CCCTTACCCCCGGCTGACTGCGTGCTCAGCACACTGTGTCTGGATGCCGCCTGCCCAGAC CTCCCCACCTACTGCAGGGCGCTCAGGAACCTCGGCAGCCTACTGAAGCCAGGGGGCTTC CTGGTGATCATGGATGCGCTCAAGAGCAGCTACTACATGATTGGTGAGCAGAAGTTCTCC AGCCTCCCCCTGGGCCGGGAGGCAGTAGAGGCTGCTGTGAAAGAGGCTGGCTACACAATC GAATGGTTTGAGGTGATCTCGCAAAGTTATTCTTCCACCATGGCCAACAACGAAGGACTT TTCTCCCTGGTGGCGAGGAAGCTGAGCAGACCCCTGTGATGCCTGTGACCTCAATTAAAG CAATTCCTTTGACCTGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAA |
Restriction Sites | Please inquire |
ACCN | NM_006169 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006169.2, NP_006160.1 |
RefSeq Size | 1579 bp |
RefSeq ORF | 795 bp |
Locus ID | 4837 |
UniProt ID | P40261 |
Domains | NNMT_PNMT_TEMT |
Protein Pathways | Metabolic pathways, Nicotinate and nicotinamide metabolism |
Gene Summary | N-methylation is one method by which drug and other xenobiotic compounds are metabolized by the liver. This gene encodes the protein responsible for this enzymatic activity which uses S-adenosyl methionine as the methyl donor. [provided by RefSeq, Jul 2008] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Expression and Functional Significance of Nicotinamide N-methyl Transferase (NNMT) in Skeletal Muscles of Patients with COPD
,Ho Cheol Kim, Mahroo Mofarrahi, Theodoros Vassilokopoulos, Francois Maltais, Ianna Sigala, Richard Debigare, Ioannis Bellenis, and Sabah N.A. Hussain,
Am. J. Respir. Crit. Care Med., Jan 2010; 10.1164/rccm.200906-0936OC
[NNMT]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200641 | NNMT (Myc-DDK-tagged)-Human nicotinamide N-methyltransferase (NNMT) |
CNY 2,400.00 |
|
RC200641L1 | Lenti ORF clone of Human nicotinamide N-methyltransferase (NNMT), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC200641L2 | Lenti ORF clone of Human nicotinamide N-methyltransferase (NNMT), mGFP tagged |
CNY 5,890.00 |
|
RC200641L3 | Lenti ORF clone of Human nicotinamide N-methyltransferase (NNMT), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC200641L4 | Lenti ORF clone of Human nicotinamide N-methyltransferase (NNMT), mGFP tagged |
CNY 5,890.00 |
|
RG200641 | NNMT (tGFP-tagged) - Human nicotinamide N-methyltransferase (NNMT) |
CNY 4,000.00 |