HLA DM (HLA-DMA) (NM_006120) Human Untagged Clone
CAT#: SC321601
HLA (untagged)-Human major histocompatibility complex, class II, DM alpha (HLA-DMA)
CNY 2,400.00
CNY 2,950.00
Product images
CNY 6,281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D6S222E; DMA; HLADM; RING6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006120.2
GGGGGGGGAAGCTGGGTTGGCTGGGTTGGTAGCTCCTACCTACTGTGTGGCAAGAAGGTA
TGGGTCATGAACAGAACCAAGGAGCTGCGCTGCTACAGATGTTACCACTTCTGTGGCTGC TACCCCACTCCTGGGCCGTCCCTGAAGCTCCTACTCCAATGTGGCCAGATGACCTGCAAA ACCACACATTCCTGCACACAGTGTACTGCCAGGATGGGAGTCCCAGTGTGGGACTCTCTG AGGCCTACGACGAGGACCAGCTTTTCTTCTTCGACTTTTCCCAGAACACTCGGGTGCCTC GCCTGCCCGAATTTGCTGACTGGGCTCAGGAACAGGGAGATGCTCCTGCCATTTTATTTG ACAAAGAGTTCTGCGAGTGGATGATCCAGCAAATAGGGCCAAAACTTGATGGGAAAATCC CGGTGTCCAGAGGGTTTCCTATCGCTGAAGTGTTCACGCTGAAGCCCCTGGAGTTTGGCA AGCCCAACACTTTGGTCTGTTTTGTCAGTAATCTCTTCCCACCCATGCTGACAGTGAACT GGCAGCATCATTCCGTCCCTGTGGAAGGATTTGGGCCTACTTTTGTCTCAGCTGTCGATG GACTCAGCTTCCAGGCCTTTTCTTACTTAAACTTCACACCAGAACCTTCTGACATTTTCT CCTGCATTGTGACTCACGAAATTGACCGCTACACAGCAATTGCCTATTGGGTACCCCGGA ACGCACTGCCCTCAGATCTGCTGGAGAATGTGCTGTGTGGCGTGGCCTTTGGCCTGGGTG TGCTGGGCATCATCGTGGGCATTGTTCTCATCATCTACTTCCGGAAGCCTTGCTCAGGTG ACTGATTCTTCCAGACCAGAGTTTGATGCCAGCAGCTTCGGCCATCCAAACAGAGGATGC TCAGATTTCTCACATCCTGCCCAGGATCTCCTCTTAGGGTAGAAGAAGTCTCTGGGACAT CCCTGGGGTGTGTGTGTAGATTTCCCACCTGGGGACTCTGCTGTCCCTGGGCTTGCATCC CAGGGATCCCAGAGTGGCCTGCCTATCACAACCACATCCCTTCCCCCCACAAGGCAATAA ATCTCATTTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006120 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006120.2, NP_006111.2 |
RefSeq Size | 1100 bp |
RefSeq ORF | 786 bp |
Locus ID | 3108 |
Domains | MHC_II_alpha, ig, IGc1 |
Protein Families | Transmembrane |
Protein Pathways | Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis |
Gene Summary | HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203106 | HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class II, DM alpha (HLA-DMA) |
CNY 2,400.00 |
|
RC203106L3 | Lenti ORF clone of Human major histocompatibility complex, class II, DM alpha (HLA-DMA), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203106L4 | Lenti ORF clone of Human major histocompatibility complex, class II, DM alpha (HLA-DMA), mGFP tagged |
CNY 5,890.00 |
|
RG203106 | HLA (tGFP-tagged) - Human major histocompatibility complex, class II, DM alpha (HLA-DMA) |
CNY 4,000.00 |