United States
Germany
Japan
United Kingdom
China
HLA (NM_182549) Human Untagged Clone
CAT＃: SC321694
HLA (untagged)-Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HLA-DQB1; HLA-DXB |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_182549.1
TCTCACTTATGTCTTGGAAGATGGCTCTGCAGATCCCTGGAGGCTTTTGGGCAGCAGCTG
TGACCGTGATGCTGGTGATGCTGAGCACCCCAGTGGCTGAGGCCAGAGACTTTCCCAAGG ATTTCTTGGTCCAGTTTAAGGGCATGTGCTACTTCACCAACGGGACAGAGCGCGTGCGGG GTGTGGCCAGATACATCTATAACCGCGAGGAGTACGGGCGCTTCGACAGCGACGTTGGGG AGTTCCAGGCGGTGACCGAGCTGGGGCGGAGCATCGAGGACTGGAACAACTATAAGGACT TCTTGGAGCAGGAGCGGGCCGCGGTGGACAAGGTGTGCAGACACAACTACGAGGCGGAGC TACGCACGACCTTGCAGCGGCAAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAG AGGCCCTCAACCACCACAACCTGCTGGTCTGCTCAGTGACAGATTTCTATCCAGCCCAGA TCAAAGTCCAGTGGTTTCGGAATGACCAGGAGGAGACAGCCGGTGTTGTGTCCACCTCCC TCATTAGGAATGGTGACTGGACCTTCCAGATTCTGGTGATGCTGGAAATAACTCCCCAGC GTGGAGACATCTACACCTGCCAAGTGGAGCACCCCAGCCTCCAGAGCCCCATCACCGTGG AGTGGCGACCTCGAGGGCCTCCACCTGCAGGACTCCTGCACTGACTCCTGAGGACTTTTG TCTGGGATTGGTCATCACTCTTCTGTAATGCCCACCTGCCCCTGCCCAGAATTCCTAGCT GCCTGTGTCATCCTGTCCCACTGAGGTCAGAGTCCTACAGTGGCTCATGCAGCCACAGGT CACCTTCTGTGATCCCCATCCCAAGGCACTGGCGGTGACTCTGCTTCCTGTACTGACCCA GAGCCTCTGCCTGTGCACTGCAAGCTGTGTCTACTCAGGCCCCAAGGGGCATCTCTGTTT CCATTCTCCCCCCACAGACCTGTCAAGAGAAGCATGACAAACAAAATCATTTACCTAACT TTAGTGCTTTTTCCCATAATTAAACCTGATTCTGAGTTAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_182549 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_182549.1, NP_872355.1 |
| RefSeq Size | 1092 bp |
| RefSeq ORF | 696 bp |
| Locus ID | 3120 |
| Gene Summary | HLA-DQB2 belongs to the family of HLA class II beta chain paralogs. Class II molecules are heterodimers consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. They play a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). Polymorphisms in the alpha and beta chains specify the peptide binding specificity, and typing for these polymorphisms is routinely done for bone marrow transplantation. However this gene, HLA-DQB2, is not routinely typed, as it is not thought to have an effect on transplantation. There is conflicting evidence in the literature and public sequence databases for the protein-coding capacity of HLA-DQB2. Because there is evidence of transcription and an intact ORF, HLA-DQB2 is represented in Entrez Gene and in RefSeq as a protein-coding locus. [provided by RefSeq, Oct 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204511 | HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2) |
CNY 2,400.00 |
|
| RC204511L1 | Lenti ORF clone of Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC204511L2 | Lenti ORF clone of Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2), mGFP tagged |
CNY 5,890.00 |
|
| RC204511L3 | Lenti ORF clone of Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204511L4 | Lenti ORF clone of Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2), mGFP tagged |
CNY 5,890.00 |
|
| RG204511 | HLA (tGFP-tagged) - Human major histocompatibility complex, class II, DQ beta 2 (HLA-DQB2) |
CNY 4,000.00 |
