U1SNRNPBP (SNRNP35) (NM_007020) Human Untagged Clone
CAT#: SC321935
U1SNRNPBP (untagged)-Human U11/U12 snRNP 35K (U1SNRNPBP), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HM-1, MGC138160 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_007020.2
CCGTCGGAAGGGAGCCCAAGCTTTGCAGAGAACATGAACGATTGGATGCCCATCGCCAAG
GAGTATGATCCACTCAAAGCGGGCAGCATTGATGGCACCGATGAAGACCCACACGACCGC GCGGTCTGGAGGGCAATGCTGGCACGATATGTCCCCAACAAAGGTGTCATAGGAGATCCC CTCCTCACCCTGTTTGTGGCCAGACTAAACTTGCAGACCAAGGAGGACAAATTAAAGGAA GTCTTTTCCCGCTATGGTGACATCCGGCGGCTTCGGCTGGTCAGGGACTTGGTCACAGGT TTTTCAAAGGGCTACGCCTTCATCGAATACAAGGAGGAGCGTGCCGTGATCAAAGCTTAC CGAGATGCTGATGGCCTGGTTATTGACCAGCATGAGATATTTGTGGACTACGAGCTGGAA AGGACTCTCAAAGGGTGGATCCCTCGGCGACTTGGAGGCGGTCTTGGGGGAAAAAAGGAG TCTGGGCAACTGAGATTTGGGGGACGGGACCGGCCTTTTCGAAAACCTATTAACTTGCCA GTTGTTAAAAACGACCTCTATAGAGAGGGAAAACGGGAAAGGCGGGAGCGATCTCGATCC CGAGAAAGACACTGGGACTCGAGGACAAGGGATCGAGACCATGACAGGGGCCGGGAGAAG AGATGGCAAGAAAGAGAGCCGACCAGGGTGTGGCCCGACAATGACTGGGAGAGAGAGAGG GACTTCAGAGATGACAGGATCAAGGGGAGGGAGAAGAAGGAAAGAGGCAAGTAGAGGCCC AACAGCAGAACCCCAAAGTGAAGTTACAGTGGAAATGAGTGGAGGGGGATTGTCTTTCAA CGCAGCGTGAGTCTAATGGTTGAATAAAACTTACTGATGATCAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_007020 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007020.2, NP_008951.1 |
RefSeq Size | 1509 bp |
RefSeq ORF | 741 bp |
Locus ID | 11066 |
Domains | RRM |
Gene Summary | The protein encoded by this gene is a homolog of the U1-snRNP binding protein. The N-terminal half contains a RNA recognition motif and the C-terminal half is rich in Arg/Asp and Arg/Glu dipeptides, which is a characteristic of a variety of splicing factors. This protein is a component of the U11/U12 small nuclear ribonucleoproteins (snRNP) that form part of the U12-type spliceosome. Alternative splicing results in multiple transcript variants encoding two distinct isoforms and representing a non-protein coding variant. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (1) has an alternate segment, which lacks the translation start codon but contains an additional ribosomal binding site (RBS), in addition to the RBS in the 5' coding region, as compared to variant 3. It uses a downstream in-frame start codon and encodes the shorter isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208918 | U1SNRNPBP (Myc-DDK-tagged)-Human U11/U12 snRNP 35K (U1SNRNPBP), transcript variant 1 |
CNY 2,400.00 |
|
RC208918L3 | Lenti ORF clone of Human U11/U12 snRNP 35K (U1SNRNPBP), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208918L4 | Lenti ORF clone of Human U11/U12 snRNP 35K (U1SNRNPBP), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG208918 | U1SNRNPBP (tGFP-tagged) - Human U11/U12 snRNP 35K (U1SNRNPBP), transcript variant 1 |
CNY 4,000.00 |
其它U1SNRNPBP产品