MRRF (NM_199177) Human Untagged Clone
CAT#: SC322027
MRRF (untagged)-Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MRFF; MTRRF; RRF |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322027
GATGTTTCCAAGGATTGTCTTCAGTCATGGCCTTGGGATTAAAGTGCTTCCGCATGGTCC
ACCCTACCTTTCGCAATTATCTTGCAGCCTCTATCAGACCCGTTTCAGAAGTTACACTGA AGACAGTGCATGAAAGACAACATGGCCATAGGCAATACATGGCCTATTCAGCTGTACCAG TCCGCCATTTTGCTACCAAGAAAGCCAAAGCCAAAGGGAAAGGACAGTCCCAAACCAGAG TGAATATTAATGCTGCCTTGGTTGAGGATATAATCAACTTGGAAGAGGTGAATGAAGAAA TGAAGTCTGTGATAGAAGCTCTCAAGGATAATTTCAATAAGACTCTCAATATAAGGACCT CACCAGGATCCCTTGACAAGATTGCTGTGGTAACTGCTGACGGGAAGCTTGCTTTAAACC AGATTAGCCAGATCTCCATGAAGTCGCCACAGCTGATTTTGGTGAATATGGCCAGCTTCC CAGAGTGTACAGCTGCAGCTATCAAGGCTATAAGAGAAAGTGGAATGAATCTGAACCCAG AAGTGGAAGGGACGCTAATTCGGGTACCCATTCCCCAATCAGCCAAATGGCCGATGACAC AGTGGCAGAACTGGACAGGCATCTGGCAGTGAAGACCAAAGAACTCCTTGGATGAAAGTC CACTGGGGCCAGCAATACTCCAGAGCCCAGTTTCTGCTGGATCCCATGGGTGGCACATTG GGACTTCTCTCCCTCCCCCATCTACACAGAAGACTGTCACCATGCTGACAGAAGCCTGTC CTTGTAAGGCCCAGCCTTCCAGGGGAACACTCAGACATGTTCATTCTCTTCCTGCTTCTG CTCTGGGCCGGTGGGTGGCTCTCAGAAAATACTTGCTGCTGGCAAAAGGCCTGTACTCAG GCATTTGCTTTGACTTGATGTTGCCAAGGGACTGAGGCCATTGGCAGGCTTAGTACCACC TGCTCCTCATCTTAGGAGTCTCCTTTTCAAATAATTAGGCTCTGTTCCCATTTTAAAACT CTGATATTGGCCTTCACCTGTGACTGGACACTTTACTAGAGGCCCATTTTCACTAAACAA TAAAATCTAAATAAATTGGAAGGAATAACAACCACAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_199177 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_199177.1, NP_954646.1 |
RefSeq Size | 1627 bp |
RefSeq ORF | 606 bp |
Locus ID | 92399 |
UniProt ID | Q96E11 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a ribosome recycling factor, which is a component of the mitochondrial translational machinery. The encoded protein, along with mitochondrial elongation factor 2, functions in ribosomal recycling at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (2) lacks an exon in the 3' coding region resulting in a frameshift, compared to isoform 1. The sequence of the 5' UTR of this variant has not been determined. The resulting isoform (2) has a shorter and distinct C-terminu |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208798 | MRRF (Myc-DDK-tagged)-Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2,400.00 |
|
RC208798L3 | Lenti ORF clone of Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208798L4 | Lenti ORF clone of Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG208798 | MRRF (tGFP-tagged) - Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,000.00 |