CD9 (NM_001769) Human Untagged Clone
CAT#: SC322329
CD9 (untagged)-Human CD9 molecule (CD9)
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BTCC-1; DRAP-27; MIC3; MRP-1; TSPAN-29; TSPAN29 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322329
CGCGCCCCCCAGTCCCGCACCCGTTCGGCCCAGGCTAAGTTAGCCCTCACCATGCCGGTC
AAAGGAGGCACCAAGTGCATCAAATACCTGCTGTTCGGATTTAACTTCATCTTCTGGCTT GCCGGGATTGCTGTCCTTGCCATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGC ATCTTCGAGCAAGAAACTAATAATAATAATTCCAGCTTCTACACAGGAGTCTATATTCTG ATCGGAGCCGGCGCCCTCATGATGCTGGTGGGCTTCCTGGGCTGCTGCGGGGCTGTGCAG GAGTCCCAGTGCATGCTGGGACTGTTCTTCGGCTTCCTCTTGGTGATATTCGCCATTGAA ATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGTGATTAAGGAAGTCCAGGAG TTTTACAAGGACACCTACAACAAGCTGAAAACCAAGGATGAGCCCCAGCGGGAAACGCTG AAAGCCATCCACTATGCGTTGAACTGCTGTGGTTTGGCTGGGGGCGTGGAACAGTTTATC TCAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTGAAGTCCTGTCCTGAT GCCATCAAAGAGGTCTTCGACAATAAATTCCACATCATCGGCGCAGTGGGCATCGGCATT GCCGTGGTCATGATATTTGGCATGATCTTCAGTACGATCTTGTGCTGTGCTATCCGCAGG AACCGCGAGATGGTCTAGAGTCAGCTTACATCCCTGAGCAGGAAAGTTTACCCATGAAGA TTGGTGGGATTTTTTGTTTGTTTGTTTTGTTTTGTTTGTTGTTTGTTGTTTGTTTTTTTG CCACTAATTTTAGTATTCATTCTGCATTGCTAGATAAAAGCTGAAGTTACTTTATGTTTG TCTTTTAATGCTTCATTCAATATTGACATTTGTAGTTGAGCGGGGGGTTTGGTTTGCTTT GGTTTATATTTTTTCAGTTGTTTGTTTTTGCTTGTTATATTAAGCAGAAATCCTGCAATG AAAGGTACTATATTTGCTAGACTCTAGACAAGATATTGTACATAAAAGAATTTTTTTGTC TTTAAATAGATACAAATGTCTATCAACTTTAATCAAGTTGTAACTTATATTGAAGACAAT TTGATACATAATAAAAAATTATGACAATGTCAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001769 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001769.2, NP_001760.1 |
RefSeq Size | 1246 bp |
RefSeq ORF | 687 bp |
Locus ID | 928 |
UniProt ID | P21926 |
Domains | transmembrane4 |
Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transmembrane |
Protein Pathways | Hematopoietic cell lineage |
Gene Summary | This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202000 | CD9 (Myc-DDK-tagged)-Human CD9 molecule (CD9) |
CNY 2,400.00 |
|
RC202000L1 | Lenti ORF clone of Human CD9 molecule (CD9), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC202000L2 | Lenti ORF clone of Human CD9 molecule (CD9), mGFP tagged |
CNY 5,890.00 |
|
RC202000L3 | Lenti ORF clone of Human CD9 molecule (CD9), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC202000L4 | Lenti ORF clone of Human CD9 molecule (CD9), mGFP tagged |
CNY 4,800.00 |
|
RG202000 | CD9 (tGFP-tagged) - Human CD9 molecule (CD9) |
CNY 4,000.00 |
|
SC119043 | CD9 (untagged)-Human CD9 molecule (CD9) |
CNY 2,400.00 |