United States
Germany
Japan
United Kingdom
China
GSTA4 (NM_001512) Human Untagged Clone
CAT＃: SC322435
GSTA4 (untagged)-Human glutathione S-transferase alpha 4 (GSTA4)
CNY 2,400.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GSTA4-4; GTA4 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322435
AGAAAGCCTGAAAAGCTATCATGGCAGCAAGGCCCAAGCTCCACTATCCCAACGGAAGAG
GCCGGATGGAGTCCGTGAGATGGGTTTTAGCTGCCGCCGGAGTCGAGTTTGATGAAGAAT TTCTGGAAACAAAAGAACAGTTGTACAAGTTGCAGGATGGTAACCACCTGCTGTTCCAAC AAGTGCCCATGGTTGAAATTGACGGGATGAAGTTGGTACAGACCCGAAGCATTCTCCACT ACATAGCAGACAAGCACAATCTCTTTGGCAAGAACCTCAAGGAGAGAACCCTGATTGACA TGTACGTGGAGGGGACACTGGATCTGCTGGAACTGCTTATCATGCATCCTTTCTTAAAAC CAGATGATCAGCAAAAGGAAGTGGTTAACATGGCCCAGAAGGCTATAATTAGATACTTTC CTGTGTTTGAAAAGATTTTAAGGGGTCACGGACAAAGCTTTCTTGTTGGTAATCAGCTGA GCCTTGCAGATGTGATTTTACTCCAAACCATTTTAGCTCTAGAAGAGAAAATTCCTAATA TCCTGTCTGCATTTCCTTTCCTCCAGGAATACACAGTGAAACTAAGTAATATCCCTACAA TTAAGAGATTCCTTGAACCTGGCAGCAAGAAGAAGCCTCCCCCTGATGAAATTTATGTGA GAACCGTCTACAACATCTTTAGGCCATAAAACAACACATCCATGTGTGAGTGACAGTGTG TTCCTAGAGATGGTATTGTCTACAGTCATGTCTTAATGGATCCCAGCTCTGTCATGGTGC TATCTATGTATTAAGTTGGGTCCTAAGTTGGGTCTTTTGTGTCAAAGAGATCATCTCTTC TAGAAATATCAACCTTTTTTGTCCAGTAAATAATTGTTAGGGGATCTTTATTGGAAAACT TTTTTGGAGAGGCTGGTATTTAAGTTAGATCTGATTGGGCTACTCATGTCCTGTAGCCAG TTCATCCTCATAATAAGAATGGGCAGGATCTCTTGTTCTCTCCTGAGTGTCTTTCTACTC TCCTGAGCGTCTTTCTGCTCTCCTTATCCTGTTCTCTTATCCTTATCCCCTCCAGTCTCT GCCTAATTTTTAGTGTTTAATAACAACCGAATGTCTAGTAAATGACTCTCCTCTGAGCTG TAATAAATAAAATGGTAGTAATGAATGCAATCAGTGTTAGCCAAAATAAAGAATTTATGA GTCATTGAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001512 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001512.2, NP_001503.1 |
| RefSeq Size | 1317 bp |
| RefSeq ORF | 669 bp |
| Locus ID | 2941 |
| UniProt ID | O15217 |
| Domains | GST_N, GST_C |
| Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
| Gene Summary | Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, which are located in a cluster on chromosome 6, are highly related and encode enzymes with glutathione peroxidase activity that function in the detoxification of lipid peroxidation products. Reactive electrophiles produced by oxidative metabolism have been linked to a number of degenerative diseases including Parkinson's disease, Alzheimer's disease, cataract formation, and atherosclerosis. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202130 | GSTA4 (Myc-DDK-tagged)-Human glutathione S-transferase alpha 4 (GSTA4) |
CNY 2,400.00 |
|
| RC202130L1 | Lenti ORF clone of Human glutathione S-transferase alpha 4 (GSTA4), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC202130L2 | Lenti ORF clone of Human glutathione S-transferase alpha 4 (GSTA4), mGFP tagged |
CNY 5,890.00 |
|
| RC202130L3 | Lenti ORF clone of Human glutathione S-transferase alpha 4 (GSTA4), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202130L4 | Lenti ORF clone of Human glutathione S-transferase alpha 4 (GSTA4), mGFP tagged |
CNY 5,890.00 |
|
| RG202130 | GSTA4 (tGFP-tagged) - Human glutathione S-transferase alpha 4 (GSTA4) |
CNY 4,000.00 |
|
| SC119179 | GSTA4 (untagged)-Human glutathione S-transferase alpha 4 (GSTA4) |
CNY 2,400.00 |
