United States
Germany
Japan
United Kingdom
China
WNT3 (NM_030753) Human Untagged Clone
CAT＃: SC322789
WNT3 (untagged)-Human wingless-type MMTV integration site family, member 3 (WNT3)
CNY 3,656.00
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | INT4; TETAMS |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_030753, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCCCACCTGCTCGGGCTGCTCCTCGGCCTCCTGCTCGGTGGCACCAGGGTCCTCGCTGGCTACC CAATTTGGTGGTCCCTGGCCCTGGGCCAGCAGTACACATCTCTGGGCTCACAGCCCCTGCTCTGCGGCTC CATCCCAGGCCTGGTCCCCAAGCAACTGCGCTTCTGCCGCAATTACATCGAGATCATGCCCAGCGTGGCC GAGGGCGTGAAGCTGGGCATCCAGGAGTGCCAGCACCAGTTCCGGGGCCGCCGCTGGAACTGCACCACCA TAGATGACAGCCTGGCCATCTTTGGGCCCGTCCTCGACAAAGCCACCCGCGAGTCGGCCTTCGTTCACGC CATCGCCTCGGCCGGCGTGGCCTTCGCCGTCACCCGCTCCTGCGCCGAGGGCACCTCCACCATTTGCGGC TGTGACTCGCATCATAAGGGGCCGCCTGGCGAAGGCTGGAAGTGGGGCGGCTGCAGCGAGGACGCTGACT TCGGCGTGTTAGTGTCCAGGGAGTTCGCGGATGCGCGCGAGAACAGGCCGGACGCGCGCTCGGCCATGAA CAAGCACAACAACGAGGCGGGCCGCACGACTATCCTGGACCACATGCACCTCAAATGCAAGTGCCACGGG CTGTCGGGCAGCTGTGAGGTGAAGACCTGCTGGTGGGCGCAGCCTGACTTCCGTGCCATCGGTGACTTCC TCAAGGACAAGTATGACAGCGCCTCGGAGATGGTAGTAGAGAAGCACCGTGAGTCCCGAGGCTGGGTGGA GACCCTCCGGGCCAAGTACTCGCTCTTCAAGCCACCCACGGAGAGGGACCTGGTCTACTACGAGAACTCC CCCAACTTTTGTGAGCCCAACCCAGAGACGGGTTCCTTTGGCACAAGGGACCGGACTTGCAATGTCACCT CCCACGGCATCGATGGCTGCGATCTGCTCTGCTGTGGCCGGGGCCACAACACGAGGACGGAGAAGCGGAA GGAAAAATGCCACTGCATCTTCCACTGGTGCTGCTACGTCAGCTGCCAGGAGTGTATTCGCATCTACGAC GTGCACACCTGCAAGTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_030753 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_030753.3, NP_110380.1 |
| RefSeq Size | 1506 bp |
| RefSeq ORF | 1068 bp |
| Locus ID | 7473 |
| UniProt ID | P56703 |
| Domains | wnt |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway |
| Gene Summary | The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211115 | WNT3 (Myc-DDK-tagged)-Human wingless-type MMTV integration site family, member 3 (WNT3) |
CNY 3,656.00 |
|
| RC211115L1 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 3 (WNT3), Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC211115L2 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 3 (WNT3), mGFP tagged |
CNY 5,890.00 |
|
| RC211115L3 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 3 (WNT3), Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC211115L4 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 3 (WNT3), mGFP tagged |
CNY 6,056.00 |
|
| RG211115 | WNT3 (tGFP-tagged) - Human wingless-type MMTV integration site family, member 3 (WNT3) |
CNY 5,256.00 |
|
| SC125305 | WNT3 (untagged)-Human wingless-type MMTV integration site family, member 3 (WNT3) |
CNY 3,656.00 |
