serum amyloid A2 (SAA2) (NM_001127380) Human Untagged Clone
CAT#: SC322799
SAA2 (untagged)-Human serum amyloid A2 (SAA2), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SAA; SAA1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001127380 edited
ATGAAGCTTCTCACGGGCCTGGTTTTCTGCTCCTTGGTCCTGAGTGTCAGCAGCCGAAGC TTCTTTTCGTTCCTTGGCGAGGCTTTTGATGGGGCTCGGGACATGTGGAGAGCCTACTCT GACATGAGAGAAGCCAATTACATCGGCTCAGACAAATACTTCCATGCTCGGGGGAACTAT GATGCTGCCAAAAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTGATCAGTTTATTTTCA GCTGAACTGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001127380 |
Insert Size | 2053 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127380.1, NP_001120852.1 |
RefSeq Size | 2053 bp |
RefSeq ORF | 252 bp |
Locus ID | 6289 |
UniProt ID | P02735 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Finally, antimicrobial activity against S. aureus and E. coli resides in the N-terminal portion of the mature protein. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (2) has an alternate 3' exon, as compared to variant 1. The resulting isoform (b) has a shorter and different C-terminus, as compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225001 | SAA2 (Myc-DDK-tagged)-Human serum amyloid A2 (SAA2), transcript variant 2 |
CNY 3,990.00 |
|
RC225001L3 | Lenti-ORF clone of SAA2 (Myc-DDK-tagged)-Human serum amyloid A2 (SAA2), transcript variant 2 |
CNY 5,890.00 |
|
RC225001L4 | Lenti-ORF clone of SAA2 (mGFP-tagged)-Human serum amyloid A2 (SAA2), transcript variant 2 |
CNY 5,890.00 |
|
RG225001 | SAA2 (tGFP-tagged) - Human serum amyloid A2 (SAA2), transcript variant 2 |
CNY 4,370.00 |
其它serum amyloid A2产品