Dermokine (DMKN) (NM_001126059) Human Untagged Clone

CAT#: SC322876

DMKN (untagged)-Human dermokine (DMKN), transcript variant 6



  "NM_001126059" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DMKN Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UNQ729; ZD52F10
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001126059, the custom clone sequence may differ by one or more nucleotides
ATGCTCGGAATAACTTCCTGCAGCGACCAACAGGCTAAAGAGGGGGAAGGTCTGGAGGGA
TCCAGCACCGGCTCCTCCTCCGGCAACCACGGTGGGAGCGGCGGAGGAAATGGACATAAA
CCCGGGTGTGAAAAGCCAGGGAATGAAGCCCGCGGGAGCGGGGAATCTGGGATTCAGAAC
TCTGAGACGTCTCCTGGGATGTTTAACTTTGACACTTTCTGGAAGAATTTTAAATCCAAG
CTGGGTTTCATCAACTGGGATGCCATAAACAAGAACCAGGTCCCGCCCCCCAGCACCCGA
GCCCTCCTCTACTTCAGCCGACTCTGGGAGGATTTCAAACAGAACACTCCTTTCCTCAAC
TGGAAAGCAATTATTGAGGGTGCGGACGCGTCATCACTGCAGAAACGTGCAGGCAGAGCC
GATCAGAACTACAATTACAACCAGCATGCGTATCCCACTGCCTATGGTGGGAAGTACTCA
GTCAAGACCCCTGCAAAGGGGGGAGTCTCACCTTCTTCCTCGGCTTCCCGGGTGCAACCT
GGCCTGCTGCAGTGGGTGAAGTTTTGG
Restriction Sites Please inquire     
ACCN NM_001126059
Insert Size 964 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001126059.1, NP_001119531.1
RefSeq Size 964 bp
RefSeq ORF 570 bp
Locus ID 93099
UniProt ID Q6E0U4
Gene Summary This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 2. The encoded isoform (6, also referred to as isoform delta) has a distinct N-terminus and is shorter than isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...