CLDN19 (NM_001123395) Human Untagged Clone

CAT#: SC322900

CLDN19 (untagged)-Human claudin 19 (CLDN19), transcript variant 2



  "NM_001123395" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CLDN19 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HOMG5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322900 representing NM_001123395.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAACTCAGGCCTCCAGCTCCTGGGCTACTTCTTGGCCCTGGGTGGCTGGGTGGGCATCATTGCT
AGCACAGCCCTGCCACAGTGGAAGCAGTCTTCCTACGCAGGCGACGCCATCATCACTGCCGTGGGCCTC
TATGAAGGGCTCTGGATGTCCTGCGCCTCCCAGAGCACTGGGCAAGTGCAGTGCAAGCTCTACGACTCG
CTGCTCGCCCTGGACGGTCACATCCAATCAGCGCGGGCCCTGATGGTGGTGGCCGTGCTCCTGGGCTTC
GTGGCCATGGTCCTCAGCGTAGTTGGCATGAAGTGTACGCGGGTGGGAGACAGCAACCCCATTGCCAAG
GGCCGTGTTGCCATCGCCGGGGGAGCCCTCTTCATCCTGGCAGGCCTCTGCACTTTGACTGCTGTCTCG
TGGTATGCCACCCTGGTGACCCAGGAGTTCTTCAACCCAAGCACACCTGTCAATGCCAGGTATGAATTT
GGCCCAGCCCTGTTCGTGGGCTGGGCCTCAGCTGGCCTGGCCGTGCTGGGCGGCTCCTTCCTCTGCTGC
ACATGCCCGGAGCCAGAGAGACCCAACAGCAGCCCACAGCCCTATCGGCCTGGACCCTCTGCTGCTGCC
CGAGAGTACGTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001123395
Insert Size 636 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001123395.1
RefSeq Size 3602 bp
RefSeq ORF 636 bp
Locus ID 149461
UniProt ID Q8N6F1
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
MW 22.1 kDa
Gene Summary The product of this gene belongs to the claudin family. It plays a major role in tight junction-specific obliteration of the intercellular space, through calcium-independent cell-adhesion activity. Defects in this gene are the cause of hypomagnesemia renal with ocular involvement (HOMGO). HOMGO is a progressive renal disease characterized by primary renal magnesium wasting with hypomagnesemia, hypercalciuria and nephrocalcinosis associated with severe ocular abnormalities such as bilateral chorioretinal scars, macular colobomata, significant myopia and nystagmus. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) contains an additional segment in the coding region compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...