IGF2 (NM_001127598) Human Untagged Clone
CAT#: SC322910
IGF2 (untagged)-Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C11orf43; GRDF; IGF-II; PP9974; SRS3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322910 representing NM_001127598.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTTTCCCCAGACCCCCAAATTATCGTGGTGGCCCCCGAGACCGAACTCGCGTCTATGCAAGTCCAA CGCACTGAGGACGGGGTAACCATTATCCAGATATTTTGGGTGGGCCGCAAAGGCGAGCTACTTAGACGC ACCCCGGTGAGCTCGGCCATGCAGACACCAATGGGAATCCCAATGGGGAAGTCGATGCTGGTGCTTCTC ACCTTCTTGGCCTTCGCCTCGTGCTGCATTGCTGCTTACCGCCCCAGTGAGACCCTGTGCGGCGGGGAG CTGGTGGACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTG AGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACG TACTGTGCTACCCCCGCCAAGTCCGAGAGGGACGTGTCGACCCCTCCGACCGTGCTTCCGGACAACTTC CCCAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGAAGCAGTCCACCCAGCGCCTGCGCAGG GGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCACGTGCTCGCCAAGGAGCTCGAGGCGTTCAGGGAG GCCAAACGTCACCGTCCCCTGATTGCTCTACCCACCCAAGACCCCGCCCACGGGGGCGCCCCCCCAGAG ATGGCCAGCAATCGGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127598 |
Insert Size | 711 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127598.2 |
RefSeq Size | 4875 bp |
RefSeq ORF | 711 bp |
Locus ID | 3481 |
UniProt ID | P01344 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
MW | 26.3 kDa |
Gene Summary | This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (3) contains two alternate exons at the 5' end, one non-coding and another coding, compared to variant 1. This results in the use of an upstream AUG (not found in variants 1 and 2) and a longer isoform (2) with a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225295 | IGF2 (Myc-DDK-tagged)-Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 3 |
CNY 2,400.00 |
|
RC225295L1 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC225295L2 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC225295L3 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225295L4 | Lenti ORF clone of Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG225295 | IGF2 (tGFP-tagged) - Human insulin-like growth factor 2 (somatomedin A) (IGF2), transcript variant 3 |
CNY 4,000.00 |